ID: 1178625421

View in Genome Browser
Species Human (GRCh38)
Location 21:34213397-34213419
Sequence TGTAATCTCAGTACTTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 412788
Summary {0: 7, 1: 223, 2: 4133, 3: 45828, 4: 362597}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178625421_1178625424 3 Left 1178625421 21:34213397-34213419 CCTCCTGAAGTACTGAGATTACA 0: 7
1: 223
2: 4133
3: 45828
4: 362597
Right 1178625424 21:34213423-34213445 GTGAGCCACTATGCCCATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178625421 Original CRISPR TGTAATCTCAGTACTTCAGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr