ID: 1178625424

View in Genome Browser
Species Human (GRCh38)
Location 21:34213423-34213445
Sequence GTGAGCCACTATGCCCATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178625423_1178625424 0 Left 1178625423 21:34213400-34213422 CCTGAAGTACTGAGATTACAGGC 0: 10
1: 940
2: 25382
3: 263006
4: 292373
Right 1178625424 21:34213423-34213445 GTGAGCCACTATGCCCATTCTGG No data
1178625420_1178625424 9 Left 1178625420 21:34213391-34213413 CCTTGGCCTCCTGAAGTACTGAG 0: 4
1: 78
2: 1494
3: 15477
4: 118549
Right 1178625424 21:34213423-34213445 GTGAGCCACTATGCCCATTCTGG No data
1178625419_1178625424 13 Left 1178625419 21:34213387-34213409 CCTGCCTTGGCCTCCTGAAGTAC 0: 19
1: 554
2: 6077
3: 75811
4: 198137
Right 1178625424 21:34213423-34213445 GTGAGCCACTATGCCCATTCTGG No data
1178625421_1178625424 3 Left 1178625421 21:34213397-34213419 CCTCCTGAAGTACTGAGATTACA 0: 7
1: 223
2: 4133
3: 45828
4: 362597
Right 1178625424 21:34213423-34213445 GTGAGCCACTATGCCCATTCTGG No data
1178625418_1178625424 16 Left 1178625418 21:34213384-34213406 CCACCTGCCTTGGCCTCCTGAAG 0: 205
1: 1816
2: 30795
3: 82942
4: 164676
Right 1178625424 21:34213423-34213445 GTGAGCCACTATGCCCATTCTGG No data
1178625416_1178625424 27 Left 1178625416 21:34213373-34213395 CCTCAAGCGATCCACCTGCCTTG 0: 102
1: 3856
2: 18637
3: 46870
4: 81391
Right 1178625424 21:34213423-34213445 GTGAGCCACTATGCCCATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178625424 Original CRISPR GTGAGCCACTATGCCCATTC TGG Intergenic
No off target data available for this crispr