ID: 1178626467

View in Genome Browser
Species Human (GRCh38)
Location 21:34222856-34222878
Sequence TGAGACTCCCTGAGAAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178626467_1178626473 9 Left 1178626467 21:34222856-34222878 CCAGTGTTTCTCAGGGAGTCTCA No data
Right 1178626473 21:34222888-34222910 TCCTGAGGACACATCCTCCATGG No data
1178626467_1178626476 25 Left 1178626467 21:34222856-34222878 CCAGTGTTTCTCAGGGAGTCTCA No data
Right 1178626476 21:34222904-34222926 TCCATGGAAGTATGTGAAGCAGG No data
1178626467_1178626472 -6 Left 1178626467 21:34222856-34222878 CCAGTGTTTCTCAGGGAGTCTCA No data
Right 1178626472 21:34222873-34222895 GTCTCAGGGGTGGTCTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178626467 Original CRISPR TGAGACTCCCTGAGAAACAC TGG (reversed) Intergenic
No off target data available for this crispr