ID: 1178627151

View in Genome Browser
Species Human (GRCh38)
Location 21:34227680-34227702
Sequence TTGGACTCCCAGGGAAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178627151_1178627157 -1 Left 1178627151 21:34227680-34227702 CCTATTTTTCCCTGGGAGTCCAA No data
Right 1178627157 21:34227702-34227724 AGAGGAAGTGAGCGGTGCAAAGG No data
1178627151_1178627155 -9 Left 1178627151 21:34227680-34227702 CCTATTTTTCCCTGGGAGTCCAA No data
Right 1178627155 21:34227694-34227716 GGAGTCCAAGAGGAAGTGAGCGG No data
1178627151_1178627158 7 Left 1178627151 21:34227680-34227702 CCTATTTTTCCCTGGGAGTCCAA No data
Right 1178627158 21:34227710-34227732 TGAGCGGTGCAAAGGAAGCCAGG No data
1178627151_1178627160 13 Left 1178627151 21:34227680-34227702 CCTATTTTTCCCTGGGAGTCCAA No data
Right 1178627160 21:34227716-34227738 GTGCAAAGGAAGCCAGGACAGGG No data
1178627151_1178627159 12 Left 1178627151 21:34227680-34227702 CCTATTTTTCCCTGGGAGTCCAA No data
Right 1178627159 21:34227715-34227737 GGTGCAAAGGAAGCCAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178627151 Original CRISPR TTGGACTCCCAGGGAAAAAT AGG (reversed) Intergenic
No off target data available for this crispr