ID: 1178631046

View in Genome Browser
Species Human (GRCh38)
Location 21:34261747-34261769
Sequence CCTGTTGGTGCCACTATACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178631046_1178631051 -7 Left 1178631046 21:34261747-34261769 CCCAGTATAGTGGCACCAACAGG No data
Right 1178631051 21:34261763-34261785 CAACAGGAAATCCTCCTGCTGGG No data
1178631046_1178631056 27 Left 1178631046 21:34261747-34261769 CCCAGTATAGTGGCACCAACAGG No data
Right 1178631056 21:34261797-34261819 TGAGAAACATGCAGATCTCAAGG No data
1178631046_1178631050 -8 Left 1178631046 21:34261747-34261769 CCCAGTATAGTGGCACCAACAGG No data
Right 1178631050 21:34261762-34261784 CCAACAGGAAATCCTCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178631046 Original CRISPR CCTGTTGGTGCCACTATACT GGG (reversed) Intergenic