ID: 1178631048

View in Genome Browser
Species Human (GRCh38)
Location 21:34261748-34261770
Sequence TCCTGTTGGTGCCACTATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178631048_1178631056 26 Left 1178631048 21:34261748-34261770 CCAGTATAGTGGCACCAACAGGA No data
Right 1178631056 21:34261797-34261819 TGAGAAACATGCAGATCTCAAGG No data
1178631048_1178631050 -9 Left 1178631048 21:34261748-34261770 CCAGTATAGTGGCACCAACAGGA No data
Right 1178631050 21:34261762-34261784 CCAACAGGAAATCCTCCTGCTGG No data
1178631048_1178631051 -8 Left 1178631048 21:34261748-34261770 CCAGTATAGTGGCACCAACAGGA No data
Right 1178631051 21:34261763-34261785 CAACAGGAAATCCTCCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178631048 Original CRISPR TCCTGTTGGTGCCACTATAC TGG (reversed) Intergenic
No off target data available for this crispr