ID: 1178631049

View in Genome Browser
Species Human (GRCh38)
Location 21:34261762-34261784
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178631049_1178631056 12 Left 1178631049 21:34261762-34261784 CCAACAGGAAATCCTCCTGCTGG No data
Right 1178631056 21:34261797-34261819 TGAGAAACATGCAGATCTCAAGG No data
1178631049_1178631057 22 Left 1178631049 21:34261762-34261784 CCAACAGGAAATCCTCCTGCTGG No data
Right 1178631057 21:34261807-34261829 GCAGATCTCAAGGCCTCCCAAGG No data
1178631049_1178631058 25 Left 1178631049 21:34261762-34261784 CCAACAGGAAATCCTCCTGCTGG No data
Right 1178631058 21:34261810-34261832 GATCTCAAGGCCTCCCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178631049 Original CRISPR CCAGCAGGAGGATTTCCTGT TGG (reversed) Intergenic