ID: 1178631051

View in Genome Browser
Species Human (GRCh38)
Location 21:34261763-34261785
Sequence CAACAGGAAATCCTCCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178631046_1178631051 -7 Left 1178631046 21:34261747-34261769 CCCAGTATAGTGGCACCAACAGG No data
Right 1178631051 21:34261763-34261785 CAACAGGAAATCCTCCTGCTGGG No data
1178631048_1178631051 -8 Left 1178631048 21:34261748-34261770 CCAGTATAGTGGCACCAACAGGA No data
Right 1178631051 21:34261763-34261785 CAACAGGAAATCCTCCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178631051 Original CRISPR CAACAGGAAATCCTCCTGCT GGG Intergenic