ID: 1178631052

View in Genome Browser
Species Human (GRCh38)
Location 21:34261774-34261796
Sequence AAGGGACACATCCCAGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 261}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178631052_1178631058 13 Left 1178631052 21:34261774-34261796 CCTCCTGCTGGGATGTGTCCCTT 0: 1
1: 0
2: 2
3: 52
4: 261
Right 1178631058 21:34261810-34261832 GATCTCAAGGCCTCCCAAGGAGG No data
1178631052_1178631061 26 Left 1178631052 21:34261774-34261796 CCTCCTGCTGGGATGTGTCCCTT 0: 1
1: 0
2: 2
3: 52
4: 261
Right 1178631061 21:34261823-34261845 CCCAAGGAGGACAGACTCTGAGG No data
1178631052_1178631063 30 Left 1178631052 21:34261774-34261796 CCTCCTGCTGGGATGTGTCCCTT 0: 1
1: 0
2: 2
3: 52
4: 261
Right 1178631063 21:34261827-34261849 AGGAGGACAGACTCTGAGGCAGG No data
1178631052_1178631056 0 Left 1178631052 21:34261774-34261796 CCTCCTGCTGGGATGTGTCCCTT 0: 1
1: 0
2: 2
3: 52
4: 261
Right 1178631056 21:34261797-34261819 TGAGAAACATGCAGATCTCAAGG No data
1178631052_1178631057 10 Left 1178631052 21:34261774-34261796 CCTCCTGCTGGGATGTGTCCCTT 0: 1
1: 0
2: 2
3: 52
4: 261
Right 1178631057 21:34261807-34261829 GCAGATCTCAAGGCCTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178631052 Original CRISPR AAGGGACACATCCCAGCAGG AGG (reversed) Intergenic