ID: 1178631053

View in Genome Browser
Species Human (GRCh38)
Location 21:34261777-34261799
Sequence TCAAAGGGACACATCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178631053_1178631057 7 Left 1178631053 21:34261777-34261799 CCTGCTGGGATGTGTCCCTTTGA No data
Right 1178631057 21:34261807-34261829 GCAGATCTCAAGGCCTCCCAAGG No data
1178631053_1178631056 -3 Left 1178631053 21:34261777-34261799 CCTGCTGGGATGTGTCCCTTTGA No data
Right 1178631056 21:34261797-34261819 TGAGAAACATGCAGATCTCAAGG No data
1178631053_1178631061 23 Left 1178631053 21:34261777-34261799 CCTGCTGGGATGTGTCCCTTTGA No data
Right 1178631061 21:34261823-34261845 CCCAAGGAGGACAGACTCTGAGG No data
1178631053_1178631058 10 Left 1178631053 21:34261777-34261799 CCTGCTGGGATGTGTCCCTTTGA No data
Right 1178631058 21:34261810-34261832 GATCTCAAGGCCTCCCAAGGAGG No data
1178631053_1178631063 27 Left 1178631053 21:34261777-34261799 CCTGCTGGGATGTGTCCCTTTGA No data
Right 1178631063 21:34261827-34261849 AGGAGGACAGACTCTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178631053 Original CRISPR TCAAAGGGACACATCCCAGC AGG (reversed) Intergenic