ID: 1178631054

View in Genome Browser
Species Human (GRCh38)
Location 21:34261792-34261814
Sequence AGATCTGCATGTTTCTCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178631054_1178631061 8 Left 1178631054 21:34261792-34261814 CCCTTTGAGAAACATGCAGATCT No data
Right 1178631061 21:34261823-34261845 CCCAAGGAGGACAGACTCTGAGG No data
1178631054_1178631063 12 Left 1178631054 21:34261792-34261814 CCCTTTGAGAAACATGCAGATCT No data
Right 1178631063 21:34261827-34261849 AGGAGGACAGACTCTGAGGCAGG No data
1178631054_1178631057 -8 Left 1178631054 21:34261792-34261814 CCCTTTGAGAAACATGCAGATCT No data
Right 1178631057 21:34261807-34261829 GCAGATCTCAAGGCCTCCCAAGG No data
1178631054_1178631058 -5 Left 1178631054 21:34261792-34261814 CCCTTTGAGAAACATGCAGATCT No data
Right 1178631058 21:34261810-34261832 GATCTCAAGGCCTCCCAAGGAGG No data
1178631054_1178631064 29 Left 1178631054 21:34261792-34261814 CCCTTTGAGAAACATGCAGATCT No data
Right 1178631064 21:34261844-34261866 GGCAGGTCTGAATTTAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178631054 Original CRISPR AGATCTGCATGTTTCTCAAA GGG (reversed) Intergenic