ID: 1178631055

View in Genome Browser
Species Human (GRCh38)
Location 21:34261793-34261815
Sequence GAGATCTGCATGTTTCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178631055_1178631061 7 Left 1178631055 21:34261793-34261815 CCTTTGAGAAACATGCAGATCTC No data
Right 1178631061 21:34261823-34261845 CCCAAGGAGGACAGACTCTGAGG No data
1178631055_1178631058 -6 Left 1178631055 21:34261793-34261815 CCTTTGAGAAACATGCAGATCTC No data
Right 1178631058 21:34261810-34261832 GATCTCAAGGCCTCCCAAGGAGG No data
1178631055_1178631057 -9 Left 1178631055 21:34261793-34261815 CCTTTGAGAAACATGCAGATCTC No data
Right 1178631057 21:34261807-34261829 GCAGATCTCAAGGCCTCCCAAGG No data
1178631055_1178631063 11 Left 1178631055 21:34261793-34261815 CCTTTGAGAAACATGCAGATCTC No data
Right 1178631063 21:34261827-34261849 AGGAGGACAGACTCTGAGGCAGG No data
1178631055_1178631064 28 Left 1178631055 21:34261793-34261815 CCTTTGAGAAACATGCAGATCTC No data
Right 1178631064 21:34261844-34261866 GGCAGGTCTGAATTTAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178631055 Original CRISPR GAGATCTGCATGTTTCTCAA AGG (reversed) Intergenic