ID: 1178631056

View in Genome Browser
Species Human (GRCh38)
Location 21:34261797-34261819
Sequence TGAGAAACATGCAGATCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178631048_1178631056 26 Left 1178631048 21:34261748-34261770 CCAGTATAGTGGCACCAACAGGA No data
Right 1178631056 21:34261797-34261819 TGAGAAACATGCAGATCTCAAGG No data
1178631052_1178631056 0 Left 1178631052 21:34261774-34261796 CCTCCTGCTGGGATGTGTCCCTT No data
Right 1178631056 21:34261797-34261819 TGAGAAACATGCAGATCTCAAGG No data
1178631046_1178631056 27 Left 1178631046 21:34261747-34261769 CCCAGTATAGTGGCACCAACAGG No data
Right 1178631056 21:34261797-34261819 TGAGAAACATGCAGATCTCAAGG No data
1178631049_1178631056 12 Left 1178631049 21:34261762-34261784 CCAACAGGAAATCCTCCTGCTGG No data
Right 1178631056 21:34261797-34261819 TGAGAAACATGCAGATCTCAAGG No data
1178631053_1178631056 -3 Left 1178631053 21:34261777-34261799 CCTGCTGGGATGTGTCCCTTTGA No data
Right 1178631056 21:34261797-34261819 TGAGAAACATGCAGATCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178631056 Original CRISPR TGAGAAACATGCAGATCTCA AGG Intergenic