ID: 1178631057

View in Genome Browser
Species Human (GRCh38)
Location 21:34261807-34261829
Sequence GCAGATCTCAAGGCCTCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178631054_1178631057 -8 Left 1178631054 21:34261792-34261814 CCCTTTGAGAAACATGCAGATCT No data
Right 1178631057 21:34261807-34261829 GCAGATCTCAAGGCCTCCCAAGG No data
1178631053_1178631057 7 Left 1178631053 21:34261777-34261799 CCTGCTGGGATGTGTCCCTTTGA No data
Right 1178631057 21:34261807-34261829 GCAGATCTCAAGGCCTCCCAAGG No data
1178631052_1178631057 10 Left 1178631052 21:34261774-34261796 CCTCCTGCTGGGATGTGTCCCTT No data
Right 1178631057 21:34261807-34261829 GCAGATCTCAAGGCCTCCCAAGG No data
1178631049_1178631057 22 Left 1178631049 21:34261762-34261784 CCAACAGGAAATCCTCCTGCTGG No data
Right 1178631057 21:34261807-34261829 GCAGATCTCAAGGCCTCCCAAGG No data
1178631055_1178631057 -9 Left 1178631055 21:34261793-34261815 CCTTTGAGAAACATGCAGATCTC No data
Right 1178631057 21:34261807-34261829 GCAGATCTCAAGGCCTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178631057 Original CRISPR GCAGATCTCAAGGCCTCCCA AGG Intergenic