ID: 1178631061

View in Genome Browser
Species Human (GRCh38)
Location 21:34261823-34261845
Sequence CCCAAGGAGGACAGACTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178631055_1178631061 7 Left 1178631055 21:34261793-34261815 CCTTTGAGAAACATGCAGATCTC No data
Right 1178631061 21:34261823-34261845 CCCAAGGAGGACAGACTCTGAGG No data
1178631054_1178631061 8 Left 1178631054 21:34261792-34261814 CCCTTTGAGAAACATGCAGATCT No data
Right 1178631061 21:34261823-34261845 CCCAAGGAGGACAGACTCTGAGG No data
1178631052_1178631061 26 Left 1178631052 21:34261774-34261796 CCTCCTGCTGGGATGTGTCCCTT No data
Right 1178631061 21:34261823-34261845 CCCAAGGAGGACAGACTCTGAGG No data
1178631053_1178631061 23 Left 1178631053 21:34261777-34261799 CCTGCTGGGATGTGTCCCTTTGA No data
Right 1178631061 21:34261823-34261845 CCCAAGGAGGACAGACTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178631061 Original CRISPR CCCAAGGAGGACAGACTCTG AGG Intergenic