ID: 1178632135

View in Genome Browser
Species Human (GRCh38)
Location 21:34271082-34271104
Sequence CACAATTATCTTGAGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178632135_1178632140 2 Left 1178632135 21:34271082-34271104 CCTTGCACCTCAAGATAATTGTG No data
Right 1178632140 21:34271107-34271129 AGGCTAGACTGCTTCAATATGGG No data
1178632135_1178632139 1 Left 1178632135 21:34271082-34271104 CCTTGCACCTCAAGATAATTGTG No data
Right 1178632139 21:34271106-34271128 CAGGCTAGACTGCTTCAATATGG No data
1178632135_1178632141 14 Left 1178632135 21:34271082-34271104 CCTTGCACCTCAAGATAATTGTG No data
Right 1178632141 21:34271119-34271141 TTCAATATGGGCAATTTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178632135 Original CRISPR CACAATTATCTTGAGGTGCA AGG (reversed) Intergenic
No off target data available for this crispr