ID: 1178632735

View in Genome Browser
Species Human (GRCh38)
Location 21:34276887-34276909
Sequence ACCCCACCACAACGAGAATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178632735_1178632738 21 Left 1178632735 21:34276887-34276909 CCCGATTCTCGTTGTGGTGGGGT No data
Right 1178632738 21:34276931-34276953 GACTAGACAGTTTGAGAAGTAGG No data
1178632735_1178632737 -6 Left 1178632735 21:34276887-34276909 CCCGATTCTCGTTGTGGTGGGGT No data
Right 1178632737 21:34276904-34276926 TGGGGTCATATGACTGTTGTAGG No data
1178632735_1178632739 26 Left 1178632735 21:34276887-34276909 CCCGATTCTCGTTGTGGTGGGGT No data
Right 1178632739 21:34276936-34276958 GACAGTTTGAGAAGTAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178632735 Original CRISPR ACCCCACCACAACGAGAATC GGG (reversed) Intergenic