ID: 1178632736

View in Genome Browser
Species Human (GRCh38)
Location 21:34276888-34276910
Sequence GACCCCACCACAACGAGAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178632736_1178632738 20 Left 1178632736 21:34276888-34276910 CCGATTCTCGTTGTGGTGGGGTC No data
Right 1178632738 21:34276931-34276953 GACTAGACAGTTTGAGAAGTAGG No data
1178632736_1178632739 25 Left 1178632736 21:34276888-34276910 CCGATTCTCGTTGTGGTGGGGTC No data
Right 1178632739 21:34276936-34276958 GACAGTTTGAGAAGTAGGAGAGG No data
1178632736_1178632737 -7 Left 1178632736 21:34276888-34276910 CCGATTCTCGTTGTGGTGGGGTC No data
Right 1178632737 21:34276904-34276926 TGGGGTCATATGACTGTTGTAGG 0: 1
1: 0
2: 1
3: 6
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178632736 Original CRISPR GACCCCACCACAACGAGAAT CGG (reversed) Intergenic