ID: 1178632737

View in Genome Browser
Species Human (GRCh38)
Location 21:34276904-34276926
Sequence TGGGGTCATATGACTGTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178632729_1178632737 22 Left 1178632729 21:34276859-34276881 CCTCAAGTTCCTGTCATAGTCAT No data
Right 1178632737 21:34276904-34276926 TGGGGTCATATGACTGTTGTAGG No data
1178632735_1178632737 -6 Left 1178632735 21:34276887-34276909 CCCGATTCTCGTTGTGGTGGGGT No data
Right 1178632737 21:34276904-34276926 TGGGGTCATATGACTGTTGTAGG No data
1178632736_1178632737 -7 Left 1178632736 21:34276888-34276910 CCGATTCTCGTTGTGGTGGGGTC No data
Right 1178632737 21:34276904-34276926 TGGGGTCATATGACTGTTGTAGG No data
1178632728_1178632737 23 Left 1178632728 21:34276858-34276880 CCCTCAAGTTCCTGTCATAGTCA No data
Right 1178632737 21:34276904-34276926 TGGGGTCATATGACTGTTGTAGG No data
1178632730_1178632737 13 Left 1178632730 21:34276868-34276890 CCTGTCATAGTCATAAGTACCCG No data
Right 1178632737 21:34276904-34276926 TGGGGTCATATGACTGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178632737 Original CRISPR TGGGGTCATATGACTGTTGT AGG Intergenic
No off target data available for this crispr