ID: 1178632738

View in Genome Browser
Species Human (GRCh38)
Location 21:34276931-34276953
Sequence GACTAGACAGTTTGAGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178632736_1178632738 20 Left 1178632736 21:34276888-34276910 CCGATTCTCGTTGTGGTGGGGTC No data
Right 1178632738 21:34276931-34276953 GACTAGACAGTTTGAGAAGTAGG No data
1178632735_1178632738 21 Left 1178632735 21:34276887-34276909 CCCGATTCTCGTTGTGGTGGGGT No data
Right 1178632738 21:34276931-34276953 GACTAGACAGTTTGAGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178632738 Original CRISPR GACTAGACAGTTTGAGAAGT AGG Intergenic
No off target data available for this crispr