ID: 1178633310

View in Genome Browser
Species Human (GRCh38)
Location 21:34281133-34281155
Sequence CCCCATGTGGAGACGGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178633310_1178633320 28 Left 1178633310 21:34281133-34281155 CCTTGGCCCGTCTCCACATGGGG No data
Right 1178633320 21:34281184-34281206 AGATCACACGTGCTCCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178633310 Original CRISPR CCCCATGTGGAGACGGGCCA AGG (reversed) Intergenic
No off target data available for this crispr