ID: 1178634467

View in Genome Browser
Species Human (GRCh38)
Location 21:34290206-34290228
Sequence GACAGCTCTTGGCCTGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178634464_1178634467 11 Left 1178634464 21:34290172-34290194 CCATTATCTGAAGGTAATTACTC No data
Right 1178634467 21:34290206-34290228 GACAGCTCTTGGCCTGCTACTGG No data
1178634463_1178634467 15 Left 1178634463 21:34290168-34290190 CCTGCCATTATCTGAAGGTAATT No data
Right 1178634467 21:34290206-34290228 GACAGCTCTTGGCCTGCTACTGG No data
1178634462_1178634467 16 Left 1178634462 21:34290167-34290189 CCCTGCCATTATCTGAAGGTAAT No data
Right 1178634467 21:34290206-34290228 GACAGCTCTTGGCCTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178634467 Original CRISPR GACAGCTCTTGGCCTGCTAC TGG Intergenic
No off target data available for this crispr