ID: 1178635094

View in Genome Browser
Species Human (GRCh38)
Location 21:34295405-34295427
Sequence TATGTGTAAGTTACTCACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178635087_1178635094 29 Left 1178635087 21:34295353-34295375 CCAATTGCTCATGGCTTCCTTGG No data
Right 1178635094 21:34295405-34295427 TATGTGTAAGTTACTCACATTGG No data
1178635093_1178635094 12 Left 1178635093 21:34295370-34295392 CCTTGGCTGGGGGTAACTGTAGT No data
Right 1178635094 21:34295405-34295427 TATGTGTAAGTTACTCACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178635094 Original CRISPR TATGTGTAAGTTACTCACAT TGG Intergenic
No off target data available for this crispr