ID: 1178635096

View in Genome Browser
Species Human (GRCh38)
Location 21:34295414-34295436
Sequence GTTACTCACATTGGTATTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178635093_1178635096 21 Left 1178635093 21:34295370-34295392 CCTTGGCTGGGGGTAACTGTAGT No data
Right 1178635096 21:34295414-34295436 GTTACTCACATTGGTATTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178635096 Original CRISPR GTTACTCACATTGGTATTGG TGG Intergenic
No off target data available for this crispr