ID: 1178639186

View in Genome Browser
Species Human (GRCh38)
Location 21:34332581-34332603
Sequence CAGGGTCACCTGTTGAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178639181_1178639186 3 Left 1178639181 21:34332555-34332577 CCTAATAGTCTTGGAGGCTAGAA No data
Right 1178639186 21:34332581-34332603 CAGGGTCACCTGTTGAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178639186 Original CRISPR CAGGGTCACCTGTTGAAAGG AGG Intergenic
No off target data available for this crispr