ID: 1178640072

View in Genome Browser
Species Human (GRCh38)
Location 21:34338332-34338354
Sequence ACCCTACGCTCCTTGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178640067_1178640072 1 Left 1178640067 21:34338308-34338330 CCCAGAGACGTGACCTGGTTGAG No data
Right 1178640072 21:34338332-34338354 ACCCTACGCTCCTTGAAGGCAGG No data
1178640068_1178640072 0 Left 1178640068 21:34338309-34338331 CCAGAGACGTGACCTGGTTGAGG No data
Right 1178640072 21:34338332-34338354 ACCCTACGCTCCTTGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178640072 Original CRISPR ACCCTACGCTCCTTGAAGGC AGG Intergenic
No off target data available for this crispr