ID: 1178643526

View in Genome Browser
Species Human (GRCh38)
Location 21:34365867-34365889
Sequence CTGTGGTCATGGAGCAGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 404}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178643521_1178643526 20 Left 1178643521 21:34365824-34365846 CCTTCAACGAAGCTGCTTTCACA 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1178643526 21:34365867-34365889 CTGTGGTCATGGAGCAGGCATGG 0: 1
1: 0
2: 4
3: 41
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178643526 Original CRISPR CTGTGGTCATGGAGCAGGCA TGG Intronic
900300210 1:1973343-1973365 CTGTGGGGAGGGAGGAGGCAGGG + Intronic
900361937 1:2293311-2293333 GTGTGCTCAGGGAGCAGTCACGG + Intronic
900736153 1:4300712-4300734 CTGTGGTCATGGAGCTGAAGTGG + Intergenic
900954132 1:5876324-5876346 CAGTGGTCAGGGAGGAGGGAGGG - Intronic
901540283 1:9910736-9910758 CTGTGCTCCTGGAGCAGATAGGG - Intergenic
901692640 1:10983493-10983515 CTGAGATCAAGGTGCAGGCAGGG - Intergenic
902731565 1:18373341-18373363 TTGTGGTCTAGAAGCAGGCAAGG + Intronic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
903889646 1:26560969-26560991 TTCTGGCCATGGAGCAGGCCAGG - Intronic
904078683 1:27858467-27858489 CTGAGGTTTTGGAGCAGGGACGG + Intergenic
904083021 1:27883877-27883899 CTCTGGCCTTGGAGCAGGTAAGG - Intronic
904305135 1:29583993-29584015 TTTTGGTCATTGAGCAAGCAGGG + Intergenic
904774794 1:32900161-32900183 CTTTGGTCAAAGAGGAGGCACGG + Intronic
904775195 1:32901771-32901793 CTGAGGTCACACAGCAGGCAGGG - Intergenic
905295775 1:36953621-36953643 ATGGGGCCATGGACCAGGCAGGG + Intronic
905317568 1:37093312-37093334 CTGGGCTGATGGACCAGGCAAGG - Intergenic
905453613 1:38072916-38072938 CTGTGAGCAGGGAGCAGCCATGG + Intergenic
908795009 1:67822348-67822370 CTGTGGTCCTGTATCAGACATGG - Intronic
911939470 1:104023077-104023099 CTGTGGACATGGGAAAGGCAGGG - Intergenic
913666956 1:121057560-121057582 CTGTGGTTGTGCAGCAGACAGGG + Intergenic
914018701 1:143844984-143845006 CTGTGGTTGTGCAGCAGACAGGG + Intergenic
914246440 1:145889314-145889336 ATGAGGTCAGGGAGCAGGGAGGG + Intergenic
914657254 1:149753187-149753209 CTGTGGTTGTGCAGCAGACAGGG + Intergenic
914783424 1:150806659-150806681 CTGGGGTCCTGGAGGGGGCATGG - Intronic
915146922 1:153800852-153800874 CTGGGGTCATGGAGGAGACTGGG - Intergenic
916057418 1:161077479-161077501 CTTTGGTCCTGGAGCAGGCCAGG + Exonic
916648951 1:166817038-166817060 CTGTGCTCTTGGGGCAGGCTGGG - Intergenic
918148499 1:181778781-181778803 CTGTGTTCAGAGAGCAGCCAGGG - Intronic
919656649 1:200203187-200203209 CTGAGGTCTTGTGGCAGGCATGG - Intergenic
919825243 1:201498907-201498929 CTGGGCTTATGCAGCAGGCATGG - Intronic
920562990 1:206952424-206952446 AGGTGGTCAAGGAGAAGGCAGGG - Intergenic
921029535 1:211325625-211325647 TTGTGGTCATGGAGAAAGGAGGG - Intergenic
921261692 1:213389925-213389947 CTGTGTTTATGGATGAGGCATGG + Intergenic
923248821 1:232160620-232160642 CTGAGGTGATGGATTAGGCAGGG + Intergenic
924771725 1:247085698-247085720 GTGTGGTCCAGGAGCAGCCAAGG - Intergenic
924775876 1:247114285-247114307 GTGTGGTCCAGGAGCAGCCAAGG + Intergenic
1062822533 10:545588-545610 CTGGGGTCAAGGTGCAGGCAGGG - Intronic
1063031524 10:2239940-2239962 CTGTGATCAGGGTGCAGGCATGG - Intergenic
1063472257 10:6297527-6297549 CTGTGGTCGTGGCACAGGTAGGG + Intergenic
1063617133 10:7610146-7610168 CTGTGGTGTTGGGTCAGGCAGGG - Intronic
1064707287 10:18086205-18086227 CTGTGGTGTTGGAGCAGGAATGG + Intergenic
1067055448 10:43047155-43047177 CTGTGCTCCTGCAGCAGGGATGG - Intergenic
1067234648 10:44437439-44437461 CTGTGTTCAGGGAGCAGGAGAGG - Intergenic
1067749725 10:48962872-48962894 CTGGGGGCATGCAGCAGGCAAGG - Intronic
1069751173 10:70745879-70745901 CTGGGGTCATGGAGGTGGCAGGG + Intronic
1069922757 10:71827039-71827061 CTGTGCTCCTGCAGCAAGCATGG - Intronic
1070009058 10:72454490-72454512 CTGTAGTCATGGGCCAGGCACGG + Intronic
1070280605 10:75045507-75045529 CTGTGGTCCTGCTTCAGGCAAGG + Intronic
1070639948 10:78160976-78160998 CTGTGATGAAGGCGCAGGCAGGG + Intergenic
1070649020 10:78221779-78221801 CTGGGGTCAGGGATCAGGGAGGG - Intergenic
1070820926 10:79353844-79353866 CTGTGGCCAGGGTGCTGGCATGG + Exonic
1070969498 10:80551904-80551926 CTGAGGTCAGGGAGCCAGCATGG + Intronic
1070969999 10:80555598-80555620 CTGAGGTCATGGAGGAGGAGGGG + Intronic
1072470331 10:95707216-95707238 CTGTGCTCTTGGAGGAGGCCAGG - Intergenic
1073479443 10:103777315-103777337 CTGAGGTCAGGGAGGCGGCAGGG + Intronic
1074705100 10:116123223-116123245 CTGTGGGCTAGGAGCAGGGATGG - Intronic
1075727316 10:124617211-124617233 CTGGGGTTGCGGAGCAGGCAGGG - Exonic
1075863660 10:125698772-125698794 CTGTGCACATGGACCTGGCAGGG - Intergenic
1076279998 10:129238334-129238356 CTGGGGTCAAGGAGCAGGGGAGG - Intergenic
1076320918 10:129580747-129580769 CTGTGGTTATGGGGCATCCATGG - Intronic
1076378964 10:130012049-130012071 CTGGGCTCCTGGAGCAGGCCAGG + Intergenic
1076391810 10:130109191-130109213 GTGTGATCAGGGTGCAGGCAGGG - Intergenic
1076611685 10:131730012-131730034 CTGTGCTCATGGTGCAGTTATGG + Intergenic
1076704597 10:132294243-132294265 AGGAGGCCATGGAGCAGGCACGG + Intronic
1077023071 11:428269-428291 CTGTGGTCAGAGAGCAGGGGAGG - Intronic
1077371662 11:2185110-2185132 CTGTGGTCATCAAGAAGGCTTGG + Intergenic
1077742704 11:4864769-4864791 CTGTAGACATGGAGGAGTCAAGG - Intronic
1078060444 11:8039567-8039589 GTGTGGCCAGGCAGCAGGCAGGG + Intronic
1080271202 11:30452390-30452412 CTGTGGGAATGGAGAAGGTATGG - Intronic
1080888842 11:36390975-36390997 CTGTGTTCATGGTCCAGGGAAGG + Intronic
1081693223 11:45092348-45092370 CTGGGGTCCTGGAGGAGTCAGGG - Intergenic
1081701147 11:45153525-45153547 CAGTGGACATGGGGGAGGCATGG + Intronic
1081763195 11:45591436-45591458 ATGTGGACAGGGAGAAGGCAAGG - Intergenic
1083187847 11:61027786-61027808 CTGTGGTCCAGGGCCAGGCAAGG + Intergenic
1083662575 11:64258594-64258616 CTGTGGTCATGGTGAAGCCGTGG - Exonic
1083804596 11:65066411-65066433 CTGTGGTCGTGGGGCAGGTCAGG + Intronic
1083988526 11:66232658-66232680 CAGCGGTGAGGGAGCAGGCAGGG - Intronic
1084403233 11:68956696-68956718 CTGGGGTGATGGAGGAGGCTAGG - Intergenic
1084637373 11:70400792-70400814 CTGTGCTCCAGGAGCAGGCTTGG + Intronic
1084716812 11:70879507-70879529 GTGTGGTCTTGGACCAGCCACGG - Intronic
1084918194 11:72447350-72447372 CTGTAGTCATGAAGAAGCCATGG + Intergenic
1085267112 11:75243469-75243491 TTGGGATCATGGAGAAGGCAAGG - Exonic
1085277153 11:75307561-75307583 CTGGTGTGATGGAGGAGGCATGG - Intronic
1085446466 11:76604188-76604210 CAGTGGTCCTGGGGCAGCCATGG - Intergenic
1085450651 11:76630131-76630153 CTGGGGTCCTGGAGAAGACAAGG - Intergenic
1085504760 11:77051639-77051661 CTGTGGGAATGGAGCATGCAGGG + Intergenic
1086698570 11:89872828-89872850 GTATGGTGATGGAGCAGGCCCGG + Intronic
1086707600 11:89971668-89971690 GTATGGTGATGGAGCAGGCCCGG - Intronic
1086985964 11:93249561-93249583 CAGTGGTCAAGGAACAAGCAGGG - Intergenic
1087396355 11:97604777-97604799 CTGCAGTAATGGAGCAGGGAAGG + Intergenic
1088561998 11:111124688-111124710 CTGGGGACATGTAACAGGCAAGG + Intergenic
1088582128 11:111326657-111326679 CTGTTGTCATGGAGCAGATGGGG - Intergenic
1089300622 11:117496644-117496666 CTGTGGTCATGGGGACTGCAGGG + Intronic
1089781436 11:120875727-120875749 CTGCAATGATGGAGCAGGCAGGG - Intronic
1089832144 11:121338243-121338265 CTGGGGTCTTGGAGCAGGCAGGG - Intergenic
1091115066 11:133005135-133005157 CAGTGGTGCAGGAGCAGGCAGGG - Intronic
1091610479 12:2003898-2003920 CTGTGGCTATGGGGGAGGCAGGG - Intronic
1091983891 12:4891812-4891834 CTCTGGGCAGGGAGCAGGGAGGG + Intergenic
1093756626 12:22860079-22860101 CTGTGGACTTGTAGCAGGTATGG + Intergenic
1094348692 12:29499151-29499173 GTGTGGCCCTGGAGCTGGCATGG - Intergenic
1094499310 12:31008358-31008380 CTGGGTTCTGGGAGCAGGCATGG - Intergenic
1094871319 12:34600726-34600748 CTGTGGGCATGAAGCTGGGACGG - Intergenic
1096520980 12:52184359-52184381 CTGTGGTCAGGTAGTGGGCAGGG - Intronic
1096677621 12:53234014-53234036 CTGTCCTCATGAACCAGGCAAGG + Intergenic
1097248582 12:57620168-57620190 GAGAGGTCATGGAGCAGACAAGG - Exonic
1097259688 12:57711121-57711143 CTGTGGGGCTGGAGCAGGGATGG - Intronic
1097709211 12:62900024-62900046 CTGTGATCAGGGTGCTGGCATGG - Intronic
1099144065 12:79016704-79016726 ATGATGTCATGGAGGAGGCATGG + Intronic
1099957636 12:89366990-89367012 CTCTGCTCATGCAGAAGGCAGGG - Intergenic
1101725619 12:107385884-107385906 CTGTGGTCCTGGCTCAGGCTAGG - Intronic
1102550777 12:113690421-113690443 CTGTGGTCATGAAGCTAGGAGGG - Intergenic
1103587441 12:121966561-121966583 CTTTGGTCATGGATGGGGCATGG - Intronic
1103907832 12:124336310-124336332 CTGTGTCCAGGGAGCAGGGATGG - Intronic
1103969558 12:124661521-124661543 CTGTTGTCATGGAGGAAGCTGGG - Intergenic
1105414127 13:20193888-20193910 CTGTGTGCATCGAGCAGGAAGGG - Intergenic
1106885103 13:34176146-34176168 CAGTGGTCATGGGGCAGGTGTGG + Intergenic
1107147294 13:37072265-37072287 CTGTGACCATGAAACAGGCAGGG + Intergenic
1111237694 13:85430942-85430964 TTGGGGTCTGGGAGCAGGCAAGG + Intergenic
1113454883 13:110441283-110441305 CTGTGGTCCTGGAACAAGCATGG - Intronic
1115126267 14:29998066-29998088 CAGTGGTCAGGGAGCGGGAATGG + Intronic
1115814074 14:37143745-37143767 CTGGGGCAATGGAGCAGACAGGG + Intronic
1118685119 14:68283297-68283319 CAGTGATCAGGTAGCAGGCAAGG + Intronic
1120923978 14:89779889-89779911 CTAAGATCATGGCGCAGGCAGGG - Intergenic
1120956945 14:90091204-90091226 GTTTGATCATGGAGCAGTCAAGG + Intronic
1121008469 14:90505547-90505569 CTGTGGTCGTGAAGCATGGAAGG - Intergenic
1121176090 14:91891843-91891865 CATTGTTCATGGAGCTGGCAAGG - Intronic
1121688525 14:95857613-95857635 TTGTGGAAATGTAGCAGGCAGGG + Intergenic
1121708592 14:96019949-96019971 CTCTGGGGATGGAGCAGGAAGGG + Intergenic
1121856303 14:97273326-97273348 ATTTGGTCATGGAGCAGGATGGG - Intergenic
1122026852 14:98884326-98884348 CTGAGGCCATGGAGCCAGCATGG - Intergenic
1122142661 14:99672150-99672172 CTGGGGGCATGGAGTGGGCAGGG + Intronic
1122275746 14:100589895-100589917 CTGTGGTCAGGGAGCAGGGCAGG + Intergenic
1122411985 14:101530190-101530212 CAGTTGTCCTGGAGCAAGCACGG + Intergenic
1122745924 14:103897190-103897212 CGGTGGCCACGGAGCAGCCAGGG + Intergenic
1122771434 14:104099643-104099665 CCGTGGACCTGGAACAGGCAGGG - Intronic
1123662236 15:22574480-22574502 CGGTGGACATGGCGCAGGGATGG + Intergenic
1123703687 15:22935229-22935251 GTGTGGCCCTGGAGCAGGGATGG + Intronic
1123946038 15:25239366-25239388 CTGTGGTCCTGGTGCAGCCCTGG + Intergenic
1124261982 15:28201027-28201049 CGGTGGACATGGCGCAGGGATGG - Intronic
1125512223 15:40298237-40298259 CTGTGGTCATGGTGAAGCCATGG + Exonic
1128381618 15:67117317-67117339 CTGTGATGAATGAGCAGGCATGG + Intronic
1128732765 15:70032571-70032593 CTGTGGTCCTGGGGCAGGGCTGG - Intergenic
1128787013 15:70405086-70405108 CTGAGGTCAAGGTGCCGGCATGG - Intergenic
1129605644 15:77023751-77023773 CTGTGGTCATGAAGGAGGCGGGG + Intronic
1129686855 15:77691253-77691275 CTGTGGCCAGGAGGCAGGCAAGG - Intronic
1131512274 15:93055990-93056012 CTGTGGCCCTGGAGCATGCGAGG - Intronic
1132124477 15:99210553-99210575 ATGTTCTCAGGGAGCAGGCAAGG + Intronic
1132670078 16:1098931-1098953 CTGTGGGGCTGGAGCAGACACGG + Intergenic
1133028198 16:2997679-2997701 CACTGGTCATGGACCAGGAAGGG + Intergenic
1133797210 16:9055857-9055879 CTGTGGTCTTACACCAGGCAAGG + Intergenic
1133819270 16:9222164-9222186 CTGAGGTCATGCAGCAGGGCTGG + Intergenic
1134128166 16:11630478-11630500 CTGTGTGCCTGGAGCAGGCGGGG - Intronic
1134194781 16:12150990-12151012 CTGTGGCCATACAGCAGACAGGG - Intronic
1134811986 16:17175571-17175593 GCGTGGTCATGGAGCCGGGAAGG + Intronic
1135425875 16:22335648-22335670 CTGTGTTCCTGGCGCAGGCCTGG - Intergenic
1136070252 16:27783108-27783130 CAGTGGGCGTGGAGCTGGCAAGG + Intergenic
1136428478 16:30184149-30184171 CTGTGGTGGGGGAGGAGGCAGGG + Intronic
1138597388 16:58036260-58036282 TTGAGGACATGAAGCAGGCAGGG + Intronic
1141667932 16:85475429-85475451 CTGGTGTCCTGAAGCAGGCAAGG + Intergenic
1141821534 16:86449533-86449555 CTGTGGCCAAGGAGGAGGGACGG + Intergenic
1142308251 16:89297851-89297873 CTGAGGTCACGCAGCAGACAGGG - Intronic
1143300066 17:5902394-5902416 CTGTGGGCAGGAGGCAGGCAGGG + Intronic
1144599655 17:16600747-16600769 CCGTGGGCGTGGAGCAGGCCTGG - Intergenic
1144714390 17:17424103-17424125 CCCGGGCCATGGAGCAGGCAGGG + Intergenic
1145038696 17:19560243-19560265 CTGGAGACATGGAGCAGGCACGG + Exonic
1145794050 17:27645395-27645417 CTGGGCTCATGGAGGAGGCAGGG + Intronic
1145799640 17:27674666-27674688 CTGAGGTCAGGGAGCACCCATGG - Intergenic
1145808851 17:27752930-27752952 CTGGGCTCATGGAGGAGGCAGGG + Intergenic
1146821170 17:35984524-35984546 CTGAGGGCATGGAGGAGGGAAGG + Intronic
1146845005 17:36176889-36176911 CTGAGGTTAGGGAGCAGCCATGG - Intronic
1146857312 17:36264824-36264846 CTGAGGTTAGGGAGCAGCCATGG - Intronic
1146863304 17:36323551-36323573 CTGAGGTTAGGGAGCAGCCATGG + Intronic
1146873224 17:36388734-36388756 CTGGGGTTAGGGAGCAGCCATGG - Intronic
1146880580 17:36439820-36439842 CTGAGGTTAGGGAGCAGCCATGG - Intergenic
1147066164 17:37924139-37924161 CTGAGGTTAGGGAGCAGCCATGG + Intergenic
1147076106 17:37989359-37989381 CTGAGGTTAGGGAGCAGCCATGG - Intronic
1147077697 17:38003700-38003722 CTGAGGTTAGGGAGCAGCCATGG + Intronic
1147087631 17:38068905-38068927 CTGAGGTTAGGGAGCAGCCATGG - Intergenic
1147093634 17:38127634-38127656 CTGAGGTTAGGGAGCAGCCATGG + Intergenic
1147103573 17:38192854-38192876 CTGAGGTTAGGGAGCAGCCATGG - Intergenic
1147548407 17:41420886-41420908 CTCTGGCCATGGAGCCAGCATGG - Exonic
1148559948 17:48600269-48600291 TTGTGGGCAGGGAGGAGGCAGGG - Intronic
1149342788 17:55703696-55703718 CTGTGGCCATGGGGCTGGCTGGG + Intergenic
1149533862 17:57416977-57416999 TTGTGGTCAAGGAGCAGAGATGG + Intronic
1149848152 17:60019372-60019394 CTGAGGTTAGGGAGCAGCCATGG - Intergenic
1149852672 17:60049418-60049440 ATATGGTCATGGGCCAGGCATGG - Intronic
1149862024 17:60127173-60127195 CTGAGGTTAGGGAGCAGCCAGGG + Intergenic
1149987124 17:61355744-61355766 CTGTGGTCAGGTATCAGGAAAGG - Intronic
1150086504 17:62275954-62275976 CTGAGGTTAGGGAGCAGCCATGG - Intronic
1150228901 17:63539219-63539241 ATGAAGTCATGGGGCAGGCAAGG - Intronic
1150743045 17:67795055-67795077 CTGTTGCCATGGAGCTGGCAGGG - Intergenic
1151757647 17:76083762-76083784 CTGTGGTCAGGGGACAGGGAGGG + Intronic
1151994717 17:77601344-77601366 CTGTGGACAGCGAGCAGGGAAGG - Intergenic
1152060014 17:78065391-78065413 TTGTGTTCATGTATCAGGCATGG - Intronic
1152766643 17:82144596-82144618 CCGAGGTCAAGGAGCAGGCCTGG + Intronic
1203164363 17_GL000205v2_random:80226-80248 CTGTGGGCATGCCCCAGGCAAGG + Intergenic
1153608884 18:6861696-6861718 TTGTGGCCATGGAGCTGCCATGG - Intronic
1155043995 18:22088027-22088049 GTGAGCTCATGGAGGAGGCAGGG - Intergenic
1155498345 18:26464195-26464217 CTGAAGTCATGGTGCCGGCAGGG + Intronic
1157595573 18:48861637-48861659 CTCAGGTCAGGGAGGAGGCAGGG + Exonic
1157790264 18:50524977-50524999 CAGTGGCCATGAAGCAGGCAGGG - Intergenic
1157974961 18:52316548-52316570 AGGTGGTCATGGAGCGGGCCCGG - Intergenic
1158204682 18:54979561-54979583 CTGTGGTCAAAGAACAGCCAGGG + Intergenic
1158906054 18:62012910-62012932 CTGTGGTTATGGAGAGAGCAGGG - Intergenic
1159285210 18:66340161-66340183 CTGTGGACATAGAGCAATCAGGG + Intergenic
1160315100 18:77836333-77836355 ATGTGGCCAAGGAGCACGCAGGG - Intergenic
1160856435 19:1220045-1220067 CTGTGGTCCTGCAGCAGCAAGGG - Intronic
1160975007 19:1788862-1788884 CCCTGGTCATGGGGCAGCCAGGG + Intronic
1162088284 19:8261584-8261606 AGGTGGTTATGGAGCAGGGAAGG + Intronic
1162779558 19:12999893-12999915 CAGTGGGCATGAATCAGGCAGGG - Intronic
1162848417 19:13412097-13412119 CTGTGGTCATGGAGGTGGGGAGG - Intronic
1163121153 19:15218862-15218884 CTGGGGTCAGGGAGCAGTAAGGG - Intergenic
1163557008 19:17998644-17998666 CGGTGGGCATGGAGCAGCCCGGG + Exonic
1164012389 19:21214943-21214965 CTTGGGACATGCAGCAGGCATGG + Intergenic
1164083093 19:21877612-21877634 CTATGCTCAGGGACCAGGCATGG - Intergenic
1164227850 19:23261590-23261612 CTGTGATCAGGGTTCAGGCAGGG + Intergenic
1164228179 19:23264527-23264549 CTGTGGGCATGGACCAGGCAGGG + Intergenic
1164232952 19:23307234-23307256 TTGTGGACAGGGACCAGGCAGGG - Intronic
1166502963 19:43354520-43354542 CGATGGTCAGGGAGCAGTCAGGG - Intronic
1166519568 19:43471368-43471390 CTCTGGTCATGGGCCAGGCGGGG - Intergenic
1166700596 19:44879458-44879480 CTGAGGGCATGGGGCAGGCGGGG + Intronic
1167098504 19:47389327-47389349 CTGTGGGCCGGGAGTAGGCAAGG + Intergenic
1168301910 19:55409713-55409735 CTGGGGTGAGGGAGCAGGAAGGG - Intergenic
926235467 2:11039887-11039909 CCCTGATCATGGAGGAGGCAGGG - Intergenic
926751045 2:16198799-16198821 CTGGGGTAATGGGGGAGGCATGG + Intergenic
927150543 2:20192937-20192959 CTGAGGTCAAGGAGCAAGCTGGG + Intergenic
928141750 2:28735491-28735513 CTGTGGTCATCCAAAAGGCAGGG - Intergenic
928696772 2:33857084-33857106 GTTTGGTGATGGAGAAGGCAGGG - Intergenic
929454845 2:42058289-42058311 CTGGGGTCAGGGAGCAGGTGTGG + Exonic
929644853 2:43616097-43616119 CTGATGTCATGGAGGAGGGATGG + Intergenic
929904666 2:46035470-46035492 AGGTGGGGATGGAGCAGGCAGGG - Intronic
931052795 2:58432630-58432652 CTGTGTGCTTGGAGCAGGAATGG + Intergenic
931833987 2:66080179-66080201 CTGTGATCATGCAGCAGGCTGGG + Intergenic
931877166 2:66526407-66526429 CTGCTGTCAGGGAGCTGGCAGGG + Intronic
931911175 2:66901882-66901904 CGGTGGCCCTGGAGCAGGAAAGG - Intergenic
932112570 2:69013905-69013927 CTGTGTCCCAGGAGCAGGCAAGG + Intronic
932308126 2:70718359-70718381 CTGTGGGCCTCTAGCAGGCAGGG - Intronic
933276472 2:80289564-80289586 CTGTGGTGATGGGGCAGGAGTGG + Intronic
933399026 2:81767617-81767639 ATGTGGTAGTGGAGAAGGCACGG + Intergenic
933975279 2:87504539-87504561 CTGTGGTCATGGGGAAGGCTGGG - Intergenic
934112449 2:88756339-88756361 GTGGGGTCAGGGAGGAGGCAGGG - Intergenic
934571577 2:95376061-95376083 CTGTGGTCACAGGGCAGGCGGGG - Intronic
934587688 2:95517936-95517958 GTATGGTGATGGAGCAGGCCCGG - Intergenic
935102988 2:100014570-100014592 CTGTGGTCAGGGCACTGGCAGGG + Intronic
935175130 2:100642612-100642634 CTGTGGGCAGGCAGCCGGCAGGG - Intergenic
935205074 2:100890242-100890264 CTGTGTCCAGGGAGCAGGCTGGG + Intronic
935600742 2:104919159-104919181 ATGTTTTCATGGACCAGGCATGG - Intergenic
936075351 2:109398187-109398209 CTGCTGTCATGGAGCATGCAGGG + Intronic
936163664 2:110102800-110102822 ATGGGGTCAGGGAGGAGGCAGGG - Intronic
936318547 2:111446274-111446296 CTGTGGTCATGGGGAAGGCTGGG + Intergenic
936524373 2:113232919-113232941 CGGCGGTCATGGGGCAGGCAAGG - Intronic
936608764 2:113981250-113981272 ATGTGGGTTTGGAGCAGGCATGG - Intergenic
937413685 2:121697699-121697721 CTGTGGACAGGGAGAGGGCAGGG + Intergenic
938013344 2:127846799-127846821 TTGAGCTCATGAAGCAGGCAAGG - Exonic
938102071 2:128504225-128504247 CTGAGGTCACAGAACAGGCACGG - Intergenic
938685589 2:133734547-133734569 CTATGGTCATGGGTCAGGCACGG + Intergenic
939914148 2:148020132-148020154 CTTTGGGGAAGGAGCAGGCAGGG - Intronic
940324322 2:152409514-152409536 GTGAGGTCATGGAGAAGGCATGG + Intronic
940374712 2:152945116-152945138 TGGTGGTGATGGAGCTGGCAGGG + Intergenic
940897841 2:159097663-159097685 CTGTGGTCAAGGTGCAGGACTGG - Exonic
942774769 2:179568079-179568101 GTGAGGTTTTGGAGCAGGCAGGG - Intronic
942887098 2:180939031-180939053 CTTTGGTCAGGGAGCAGACATGG - Intergenic
944130745 2:196345284-196345306 CAGTGGTTATGCAGCAAGCAGGG - Intronic
944186626 2:196956137-196956159 CTCTGGCCAGGCAGCAGGCAAGG - Intergenic
947363431 2:229369564-229369586 CTGTGGTGGTGGAGGAGGGAAGG + Intronic
947625895 2:231618538-231618560 CTGTGATCAAGGTGCAGGCCAGG - Intergenic
948762438 2:240200431-240200453 CTGTGGTCAGGAAGCTGGCCTGG - Intergenic
948794652 2:240396111-240396133 CTGAGGTCATGGACCTGCCAGGG + Intergenic
948836776 2:240629685-240629707 CTGCTGTCATGGGGCAGGAAAGG - Intronic
948913672 2:241019192-241019214 GTGTGGACCAGGAGCAGGCAGGG + Intronic
948952949 2:241266670-241266692 CTGTGGTTGTGGGGCAGGGAGGG - Intronic
1169267329 20:4174657-4174679 CTGTGGTCAGGGAAGAAGCAGGG + Intronic
1170539141 20:17370791-17370813 CTGCAGTTATGGAGGAGGCAGGG - Intronic
1172447272 20:34999768-34999790 CTGTGGATACAGAGCAGGCAGGG - Intronic
1172449651 20:35012924-35012946 CTGAGGTCAGGGACCAGACAAGG + Intronic
1172612731 20:36263881-36263903 CAGTGGTCCTGGAGCAGGTGGGG - Intronic
1173403869 20:42748317-42748339 CAGTGATCAGAGAGCAGGCATGG - Intronic
1173646706 20:44637777-44637799 CTGAGGTCATCCAGCTGGCAGGG + Intronic
1174032949 20:47645272-47645294 CGGGAGTCAGGGAGCAGGCAGGG + Intronic
1174269221 20:49354892-49354914 CTAAGGTCATGCAGCAGGCCAGG - Intergenic
1175041612 20:56057424-56057446 CTATTGTCATGGAGCAGACATGG - Intergenic
1176002677 20:62840046-62840068 GTGTGGGCATGGTGCGGGCATGG - Intronic
1176053413 20:63132709-63132731 CTGAGGTCACACAGCAGGCAAGG + Intergenic
1176337246 21:5610581-5610603 CTGTGGGCATGCCCCAGGCAGGG - Intergenic
1176470908 21:7105807-7105829 CTGTGGGCATGCCCCAGGCAGGG - Intergenic
1176494469 21:7487585-7487607 CTGTGGGCATGCCCCAGGCAGGG - Intergenic
1176506173 21:7650798-7650820 CTGTGGGCATGCCCCAGGCAGGG + Intergenic
1178643526 21:34365867-34365889 CTGTGGTCATGGAGCAGGCATGG + Intronic
1179456947 21:41506953-41506975 CTGTGGGCAGGGAGCACCCAGGG - Intronic
1179466574 21:41579729-41579751 CTGGGTTCATGGAGCAGGCATGG - Intergenic
1180982076 22:19883269-19883291 CAGGGGTGGTGGAGCAGGCAGGG + Intronic
1181206313 22:21255626-21255648 CCGGGGTCATGGTGCAGGCTCGG + Intergenic
1181781193 22:25194748-25194770 CTGTGGTGCTGGAGGAGACAAGG - Exonic
1181923974 22:26342951-26342973 AGGTGGACATGTAGCAGGCAGGG - Intronic
1182394131 22:30023069-30023091 GTGGGGTCAGGGAGCAGGAAAGG - Intronic
1182859228 22:33544831-33544853 CTGTGGTCTTGCAGCTGGCCAGG + Intronic
1183353214 22:37344892-37344914 CTCTGGGCATGGAGGCGGCATGG - Intergenic
1183700715 22:39449459-39449481 CTCTGGGCAGGGAGCAGGGAGGG + Intergenic
1183744715 22:39685879-39685901 CCGGGGTCCTGGAGCAGGCGCGG - Exonic
1184109043 22:42384490-42384512 CTGGGGGCATGGAGCAGAGAGGG - Exonic
1184273266 22:43396756-43396778 CTGGGGTGATGTGGCAGGCAGGG + Intergenic
1184425347 22:44405980-44406002 CTGTGAACATGGAGGAGGCTGGG - Intergenic
1184748977 22:46473373-46473395 CTGAGGACATGGAGGAGGAAAGG + Intronic
1184827790 22:46964831-46964853 CTGTGGTCACTCAACAGGCATGG - Intronic
1185318687 22:50190394-50190416 CTGTGGCCATGGACAGGGCAGGG - Intronic
1203220607 22_KI270731v1_random:39797-39819 CCGGGGTCATGGTGCAGGCTCGG - Intergenic
1203270217 22_KI270734v1_random:47025-47047 CCGGGGTCATGGTGCAGGCTCGG + Intergenic
949213132 3:1529914-1529936 CAGTGGTCATGAAGCAGATAAGG + Intergenic
950882852 3:16337115-16337137 CTGTCCTCATGGCGTAGGCAGGG - Intronic
951710565 3:25581846-25581868 CTGAGGTCAGGGAGCTGGCATGG - Intronic
952963225 3:38605804-38605826 CTGTGGGCATGGTGCATGCTGGG - Intronic
955303675 3:57809046-57809068 CTGTGCTCTTGGTGGAGGCAGGG + Intronic
956685480 3:71823632-71823654 TTGTGTTCATGAAGCAGGAAAGG + Intergenic
957497439 3:81009350-81009372 CTATGGTGGTGGAGCAGTCATGG + Intergenic
958195240 3:90235401-90235423 CTCTGGTCATGGAGCAAGGTTGG + Intergenic
959499790 3:107092967-107092989 GTGTGTTCATGGAGCAGCAAGGG + Intergenic
960938625 3:122919220-122919242 CTGTGCTCATGGGGCAGCCAGGG + Intronic
961597330 3:128028831-128028853 CAGTGGTCAGGGATCAGGAAGGG + Intergenic
961754442 3:129119792-129119814 CGGTGGTCAGGGAGGGGGCAGGG - Intronic
962213157 3:133496244-133496266 CTGTGGTGATGCTGCAGGGAGGG - Intergenic
962843910 3:139258879-139258901 CTGGAGTCATGGAGGAGGCAAGG + Intronic
964969027 3:162537105-162537127 CTGTGGCCATGGACCAGGTCTGG - Intergenic
965839068 3:172882334-172882356 CAGTGGGAATGAAGCAGGCAGGG + Intergenic
967983451 3:195078877-195078899 CTGTGGTCAAGGTGAAGGGAAGG - Intronic
968428471 4:538197-538219 CAGAGGTCATGGATGAGGCATGG + Intronic
968498319 4:931534-931556 CTGGGGTTATTGAGCAGGCAGGG - Intronic
968619524 4:1597516-1597538 CTGGGGGTCTGGAGCAGGCAGGG - Intergenic
968816368 4:2823823-2823845 CTGTGGCCAGGGTGCAGGCCGGG - Intronic
968869517 4:3234565-3234587 CTGTGGGCATGGAGGACTCAGGG + Intronic
968917913 4:3505261-3505283 CAGTGGTGGGGGAGCAGGCATGG + Intergenic
968990279 4:3906355-3906377 CTGTGGTCATGGCCCAGGAGAGG - Intergenic
969323236 4:6425686-6425708 CTGTGGTGATGGGGATGGCAGGG - Intronic
969463441 4:7340959-7340981 CTCTGGCCATGCAGCAGGGATGG - Intronic
970796027 4:19914471-19914493 CTGTGGTCATACAGCTGGTAAGG + Intergenic
971858265 4:32071617-32071639 CTGTGGCCATGGAGCAAGAGAGG - Intergenic
973791071 4:54378701-54378723 CTGAGATCAGGGTGCAGGCATGG + Intergenic
979210974 4:118102359-118102381 CTGTGGTCATGGAGGAGGTAAGG - Intronic
981670461 4:147280214-147280236 TTCTGGTCTTGGAGAAGGCACGG - Intergenic
981783883 4:148456058-148456080 TTATGGCCATGGAGCTGGCAAGG - Intergenic
984595975 4:181668440-181668462 CTGAGGTCAAGGTGCAGGCAGGG + Intergenic
984878286 4:184388850-184388872 CTGGGGTCATGGAGGAAGAAAGG + Exonic
985124953 4:186683739-186683761 CTGTGGTCATGGACCCATCAAGG + Intronic
987394090 5:17404623-17404645 CTGTGTTCATGGAGGAGGGTGGG + Intergenic
992263100 5:74990376-74990398 CTTTGGTCAGCGAGCAGACATGG - Intergenic
993964581 5:94345892-94345914 TTGTGATCATTGAGCAAGCAGGG + Intronic
994705957 5:103206886-103206908 CTGCGGACAGGGAGCAGGGAAGG + Intronic
994926206 5:106120456-106120478 GTGTGGTCGTGGTGCAGGAAGGG - Intergenic
995395859 5:111686213-111686235 CTCTGTTAATGGAGCAGTCAGGG + Intronic
995466559 5:112455886-112455908 ATTTAGTCATGGACCAGGCACGG + Intergenic
996131129 5:119782066-119782088 GTTTGGTCATGGTGCATGCAGGG + Intergenic
997653181 5:135536931-135536953 CTCCGGGCATGGGGCAGGCAAGG - Intergenic
997719437 5:136065909-136065931 CAGTGGTCAGGGCTCAGGCAAGG - Intergenic
999066079 5:148686828-148686850 CTAAGATCATGGAGCTGGCAGGG - Intergenic
1000261036 5:159588934-159588956 CTGTGGTCAGGGAACACCCAAGG - Intergenic
1001631671 5:173179903-173179925 GCGAGGTCATGGAGGAGGCAAGG + Intergenic
1001644632 5:173271090-173271112 CAGTCGCCATGGCGCAGGCATGG + Intergenic
1001747075 5:174100103-174100125 CTGGGGTCATGGAGCATGTGGGG + Intronic
1001766966 5:174257292-174257314 CTGTGGTCATGATGCAAACAGGG + Intergenic
1001801215 5:174545855-174545877 CTGTGAGAATGGAGAAGGCAAGG + Intergenic
1002262148 5:178000897-178000919 CTGTGGTCACACAGCAAGCAAGG - Intergenic
1002308295 5:178297148-178297170 CTGTGTTCCTGCAGCCGGCATGG + Intronic
1002578992 5:180195853-180195875 CTGTGGGCAGGGAGGATGCACGG - Intronic
1003566227 6:7224789-7224811 CTGTGGTCAAGGCCCAGGGAAGG - Intronic
1004823242 6:19392819-19392841 CTTTGGGCAGGGAGCAGGTAAGG - Intergenic
1005952886 6:30644446-30644468 CTCTGGGCATGGAGCAGGGAAGG - Intronic
1006450725 6:34104274-34104296 CTGGGGACATGGAGCAGGCTGGG + Intronic
1006933352 6:37700525-37700547 CTGTGTTGAGGCAGCAGGCAGGG - Intergenic
1007234859 6:40383412-40383434 CAGAGGTCTGGGAGCAGGCAGGG - Intergenic
1007298108 6:40844044-40844066 AGGGGGTCATGGAGCAGGCTTGG + Intergenic
1008550143 6:52621022-52621044 CTGTGGTCAGGGTGAAGGTAGGG + Intergenic
1009456026 6:63857576-63857598 CGGTGGTCATGGAGCACCCTAGG - Intronic
1010040621 6:71378663-71378685 CTGTGGAGATGGAGAAGTCATGG + Intergenic
1010068635 6:71716018-71716040 CTGTGGCGATGGAGCAGGTTTGG + Intergenic
1010635513 6:78254791-78254813 CTGTGGTCAGGAAGCAGACTGGG + Intergenic
1012287166 6:97404803-97404825 CTGTGGCCATGCTGCAGGCCTGG - Intergenic
1012290837 6:97453573-97453595 ATGTGTTCCTGGAGCAGCCAGGG + Intergenic
1014561563 6:122897460-122897482 CTGTGGACATGGATCAGGTTTGG - Intergenic
1015350280 6:132210138-132210160 CTCTGGTCATGAAGCAGAGAGGG + Intergenic
1016619503 6:146091559-146091581 GTGTGTTCAGGGAGCAGCCAGGG + Intronic
1017116768 6:150985060-150985082 CAGTGATGATGGAGAAGGCATGG + Intronic
1017770144 6:157638455-157638477 CTGTGTCCATGGAGAAGGCCAGG - Intronic
1018587953 6:165384001-165384023 CTGTAGTCCTGGAACAGACAGGG + Intronic
1018847370 6:167564972-167564994 CTGTGGGCAGTGTGCAGGCACGG + Intergenic
1019254975 7:43834-43856 CTGTTGTAAAGGAGCAGACAGGG + Intergenic
1019522745 7:1468040-1468062 CTGGGGTCGTGGACCAGGCATGG - Intergenic
1019670421 7:2275032-2275054 CTGTGGTCCTGGCTCAGGGATGG - Intronic
1020131831 7:5563078-5563100 CTCTTGGCTTGGAGCAGGCAGGG + Intronic
1020251183 7:6469724-6469746 CTGTGGCATAGGAGCAGGCAAGG + Exonic
1022116467 7:27265296-27265318 CTGTGGACATGGAACTGGAAGGG + Intergenic
1023177690 7:37449072-37449094 CAGTGGGCAGGGACCAGGCAGGG - Exonic
1025743986 7:64226812-64226834 TTGTAGGCAGGGAGCAGGCAGGG + Intronic
1025784061 7:64628082-64628104 CTGTAGGCATGGCACAGGCAAGG - Intergenic
1026006641 7:66605364-66605386 CTGCTTTGATGGAGCAGGCACGG + Intergenic
1029902111 7:104052398-104052420 CTCTGGACTTGGAGTAGGCAGGG - Intergenic
1031632411 7:124060470-124060492 CTGTGATCATGGAGCAGAGAAGG - Intergenic
1031943045 7:127809481-127809503 CTGGCGTCTGGGAGCAGGCAGGG + Intronic
1031992470 7:128207248-128207270 CTGCTGTCATGGAAAAGGCAGGG - Intergenic
1032144401 7:129366154-129366176 CTGTGGTCATAGAGGAGCTATGG - Intronic
1032368945 7:131327555-131327577 TTGTAGTTATGGAGCAGGAAGGG - Intronic
1033595575 7:142855840-142855862 CTGTGGTCATGGAGCTGGGGGGG - Intronic
1035086554 7:156264480-156264502 CTGGGCTCATGGTGCAGGTAGGG + Intergenic
1036126188 8:6064858-6064880 CTGTTGGCATGAAGCAGGCAGGG - Intergenic
1036293896 8:7519529-7519551 CTTGGGTCTTGGGGCAGGCAAGG - Intergenic
1036760424 8:11504885-11504907 CTGTGGCCATGTTTCAGGCAAGG + Intronic
1038334411 8:26634871-26634893 CTGAGGTCATCGCCCAGGCACGG + Exonic
1038776205 8:30533225-30533247 CTGCGATCATGGAGTATGCAGGG + Intronic
1039558771 8:38496259-38496281 CTGTGGTCCTGGTGCTGGGAAGG + Intergenic
1039816483 8:41099253-41099275 GTGTGGCCCTGGAGCAGACAGGG - Intergenic
1041176244 8:55199940-55199962 CTGAGGTCAGGTAGCTGGCAAGG + Intronic
1041251792 8:55941296-55941318 CTGCAGTCAAGGAGCAGGTAGGG - Intronic
1041524421 8:58789371-58789393 GTGTGGGCATGGACCTGGCAGGG + Intergenic
1046143801 8:110130196-110130218 CTCTTGTAATAGAGCAGGCAGGG - Intergenic
1047724323 8:127670923-127670945 GTGTGGTCATGGAGCTGCCAGGG + Intergenic
1048340028 8:133531555-133531577 CTGGGGTCAGGGAGGTGGCAGGG - Intronic
1048479981 8:134780450-134780472 ATGTGGACAAGGAGCAGGTAGGG - Intergenic
1049046549 8:140156635-140156657 CAGAGGTCATGGAGGAAGCAGGG - Intronic
1049288291 8:141788368-141788390 CTGTGGGCGTGGAGCACGGAGGG - Intergenic
1049325309 8:142018403-142018425 GTGTGGGCAAGGAGCAGCCAGGG - Intergenic
1049342813 8:142122569-142122591 CTGTGGGTCTGGGGCAGGCAAGG - Intergenic
1049351092 8:142165206-142165228 CTGTGCTCACCCAGCAGGCAGGG - Intergenic
1049685056 8:143936056-143936078 CTGTGGGCACAGAGCAGGCCTGG - Intronic
1049698739 8:143996939-143996961 CTATGGTGATGGTGCAGGCAGGG + Intronic
1053456524 9:38237219-38237241 ATTTGGTGATGGATCAGGCAGGG + Intergenic
1058263719 9:102872064-102872086 GTGTAGGCATGCAGCAGGCAGGG - Intergenic
1058850813 9:109010838-109010860 GTGATGTCATGGAGGAGGCAGGG - Intronic
1059363633 9:113768098-113768120 CTATGGTCATGGACCAGGCCAGG - Intergenic
1059808185 9:117827360-117827382 CAGTGGTCATGGACCAAGCTGGG + Intergenic
1059943830 9:119385632-119385654 CTGTGCTTATGAACCAGGCAGGG + Intergenic
1061195055 9:129102954-129102976 CTGTGGTAATTAAGCAGGCCTGG + Intronic
1061527408 9:131178120-131178142 CTGTGTTAATGGAGTAGGCCAGG + Intronic
1061540357 9:131275064-131275086 CTGGGGTCAGGAAGCAGGCCAGG + Intronic
1061923556 9:133795131-133795153 CTCTGCCCATGAAGCAGGCATGG - Intronic
1062000821 9:134214814-134214836 CTGTTGTCAGGGAGCCAGCATGG + Intergenic
1062344661 9:136109274-136109296 CTGAGGGCATGGGGCAGGCCTGG - Intergenic
1062356861 9:136169201-136169223 CTGTGGCCAAGGAGGGGGCAAGG + Intergenic
1062622255 9:137428388-137428410 GGGTGGGCAGGGAGCAGGCAGGG + Intronic
1062636577 9:137494674-137494696 ATGAGGTCATGGAGCAGGTGAGG - Intronic
1203442942 Un_GL000219v1:28358-28380 CTGTGGACATGACCCAGGCAGGG + Intergenic
1203513750 Un_KI270741v1:147267-147289 CTGTGGACATGACCCAGGCAGGG + Intergenic
1185736822 X:2501399-2501421 CTGTGGTCCTGGAGGAGGTGTGG - Intronic
1185806134 X:3059101-3059123 CGATGGTCATGGAGCTGCCATGG + Intronic
1186630154 X:11340008-11340030 CTGTGGAGATGGAGAAGGGATGG - Intronic
1195218207 X:102721272-102721294 CTGTGGTGCTGGATCAGGAAAGG + Intronic
1196027324 X:111054789-111054811 CTGAGGTGATGGTGGAGGCAGGG - Intronic
1197743205 X:129911751-129911773 CTGTGGATCTGAAGCAGGCAAGG - Exonic
1199311274 X:146322996-146323018 CTGTGGTCAGGAAGAAGGCAAGG + Intergenic
1199815927 X:151396996-151397018 CTGTGCTCGAGGAGCAGGCCTGG - Intronic
1199848343 X:151707634-151707656 CTGAGGTCAAGGTGCTGGCAGGG + Intergenic
1200310106 X:155069907-155069929 CCGTCCTCATGGAGCAGGAACGG - Intronic
1201272930 Y:12272877-12272899 CAATGGTCATGGAGCTGCCATGG - Intergenic