ID: 1178645553

View in Genome Browser
Species Human (GRCh38)
Location 21:34382034-34382056
Sequence AGAGAGCTGCAGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 628
Summary {0: 2, 1: 1, 2: 3, 3: 54, 4: 568}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178645547_1178645553 25 Left 1178645547 21:34381986-34382008 CCTGTCTCAAAAGAAAAAAAAAA 0: 273
1: 14034
2: 18455
3: 32364
4: 60697
Right 1178645553 21:34382034-34382056 AGAGAGCTGCAGAAGGTGGAAGG 0: 2
1: 1
2: 3
3: 54
4: 568
1178645546_1178645553 26 Left 1178645546 21:34381985-34382007 CCCTGTCTCAAAAGAAAAAAAAA 0: 340
1: 14375
2: 19561
3: 38797
4: 153769
Right 1178645553 21:34382034-34382056 AGAGAGCTGCAGAAGGTGGAAGG 0: 2
1: 1
2: 3
3: 54
4: 568

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178645553 Original CRISPR AGAGAGCTGCAGAAGGTGGA AGG Intronic
901727132 1:11250678-11250700 AGAGAGCTGGGCAAGGGGGATGG - Intronic
901794700 1:11673523-11673545 AGAGAGCTGCCCAGGCTGGAAGG - Intronic
902526368 1:17060481-17060503 AGAGAGCTGCAGAACGTTAAAGG + Intergenic
903673223 1:25048497-25048519 AGAGAGGAGAAGAAGGTGAAGGG - Intergenic
903741754 1:25562518-25562540 ATGGAGCTGCAGAAGCTGCAGGG + Intronic
903754900 1:25653828-25653850 TGAGAACTGGAGAAGATGGATGG - Intronic
903934878 1:26888758-26888780 AGAGAGCTACAGATGGTGTTAGG - Intronic
904570250 1:31458959-31458981 AGAGACCTCCAGAAGGTGAGGGG + Intergenic
904633030 1:31857387-31857409 AGAGAGCTCCACTAGGTGGTTGG + Intergenic
904851975 1:33466447-33466469 ACTGTGCTGCAGAACGTGGAGGG + Intergenic
905150962 1:35927112-35927134 AGTGAGCTGCAAAAGGAGGAAGG + Exonic
905282976 1:36860712-36860734 AGAGAGGGGAAGCAGGTGGAGGG + Intronic
905313073 1:37064091-37064113 AGAGAGGAGCAGAAGGGCGAGGG + Intergenic
905654053 1:39674699-39674721 AGAGAGAAGCAGAAGGAGGGAGG + Intergenic
906013955 1:42556223-42556245 AGAGAGGGGCAGAAGGAGGAGGG + Exonic
906018886 1:42609114-42609136 GAAGAGGTGGAGAAGGTGGAAGG - Intronic
906098358 1:43239436-43239458 ACAGGGCTGTAGAGGGTGGAGGG + Intronic
906124442 1:43418835-43418857 AAAGAGCAGCAGCAGGAGGAGGG + Intronic
906298078 1:44661377-44661399 AGAAAGCTGCACATGGTGGTGGG - Intronic
906559170 1:46742359-46742381 AGCGAGCTAAAGCAGGTGGAAGG + Intergenic
907192836 1:52663130-52663152 AGAGAGATGGAGAAGAGGGAGGG - Intronic
907823358 1:57991892-57991914 CTAGAGCTGCTGATGGTGGAAGG + Intronic
907855808 1:58302386-58302408 AGAGAGGAGTAGAGGGTGGAGGG + Intronic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
909979815 1:82085363-82085385 GAAGAGGTGGAGAAGGTGGAGGG + Intergenic
910028619 1:82688927-82688949 ACAGAGCTGCAGTGGGTGCATGG - Intergenic
910035430 1:82782506-82782528 AGGGAGCTGCAGAAGGGAGGAGG - Intergenic
910173550 1:84403577-84403599 GGAGAGGTGGGGAAGGTGGAAGG + Intronic
910303185 1:85731187-85731209 AGAGAGCTACAGAATGGGGCGGG - Intronic
910432687 1:87174673-87174695 ACAGAGCTGCGGAGGGTGGGTGG + Intergenic
910758795 1:90716488-90716510 AGAGATCTGCTGAAGGCTGAAGG + Intronic
911300191 1:96163393-96163415 AGAGGGTTGCAGAAGAGGGATGG + Intergenic
911320984 1:96413736-96413758 AGCTATCTGCAGAAAGTGGATGG + Intergenic
911647697 1:100353188-100353210 AGGGAGCTGCAGAGGGAGCAAGG - Intronic
912567270 1:110597084-110597106 TGAGAGCTGCAGAAGGAAGCAGG - Intronic
912570718 1:110619107-110619129 AGGCAGCTGCAGAGGGTGGTTGG - Intronic
912626027 1:111204801-111204823 AGAGACCTGGAGATGGTCGAAGG - Intronic
912999112 1:114562150-114562172 AGAGGGAGGTAGAAGGTGGAAGG - Intergenic
913017761 1:114757049-114757071 TGAGAACTACAGGAGGTGGAAGG + Intronic
913962979 1:143353765-143353787 TGAGGGCTGCAGACGGTGGGCGG + Intergenic
914057334 1:144179350-144179372 TGAGGGCTGCAGACGGTGGGCGG + Intergenic
914121812 1:144787016-144787038 TGAGGGCTGCAGACGGTGGGCGG - Intergenic
914923727 1:151865375-151865397 AGGGAGTTGCAGCAGGAGGAAGG - Intergenic
915016493 1:152738753-152738775 AGAGAGCAGCAGGAGGTGGGAGG + Intronic
915607853 1:156964819-156964841 TGAGAGCCCCAGAAGGTGGTGGG + Intronic
915625374 1:157111241-157111263 AAGGAGCTGCACAGGGTGGAGGG + Intergenic
915900100 1:159840615-159840637 TGAGAGAGGCAGATGGTGGAAGG + Intronic
915906367 1:159880770-159880792 AGAGAGATGCAGACAGAGGAGGG + Intronic
917790288 1:178495002-178495024 AGGGAGCTGGAGGAGGTGGCCGG - Intergenic
918127853 1:181600108-181600130 AGAAATCTGCAGAAGTGGGAGGG + Intronic
918771173 1:188562222-188562244 AGACATCTGAAGAAGGTGGAAGG + Intergenic
919567459 1:199206853-199206875 GCAGAGATGCAGAAGATGGAAGG + Intergenic
920051678 1:203168148-203168170 AGAGAGGTGCAGAGTGGGGAGGG + Intronic
920131201 1:203733153-203733175 AGAGAGGTGAAGAAAGAGGAAGG - Intronic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
921581759 1:216903778-216903800 CCAGAGCTGCAGAGGGTGGTTGG - Intronic
921693896 1:218184826-218184848 GGAGAACAGGAGAAGGTGGATGG - Intergenic
922010106 1:221574986-221575008 ACAGAATTGAAGAAGGTGGAAGG - Intergenic
922401659 1:225264747-225264769 AGATAGCTGTAGAAAGGGGAAGG + Intronic
922977779 1:229799505-229799527 AGAGAGCTGGAAAAGAAGGATGG + Intergenic
923191130 1:231621875-231621897 AGACATCTACAGAAGGTTGATGG + Intronic
923380432 1:233411917-233411939 AGGGAACTGCAGAAGCAGGAAGG + Intergenic
923975072 1:239253807-239253829 AGAAAGCTGGGGATGGTGGATGG - Intergenic
924693023 1:246370074-246370096 AGAGGGTTGCAGACAGTGGAAGG - Intronic
924703772 1:246481195-246481217 ACAGATCTGCAGAAGGAAGATGG - Intronic
1063330954 10:5158842-5158864 AAAGTGCTTCAGAAGGTGCATGG - Intergenic
1063488200 10:6439522-6439544 AAAGAGGTGGAGGAGGTGGAAGG - Intronic
1063662757 10:8045289-8045311 AGTGAGCAGGAGAAGGCGGAGGG + Intergenic
1063908970 10:10810651-10810673 GGAGACCGGCAGAAGGAGGAAGG + Intergenic
1065130347 10:22613630-22613652 AGGGGACTGCAGAATGTGGATGG + Intronic
1066200954 10:33142330-33142352 AGGGAGCTGCTGATGGAGGAGGG + Intergenic
1066314314 10:34228806-34228828 AGAGAGTTTCACATGGTGGAGGG - Intronic
1066453041 10:35548728-35548750 AAAGAGGTGGAGAAGGTGGAAGG + Intronic
1067004458 10:42647723-42647745 TGAAAGTTGCAGAAGCTGGAGGG + Intergenic
1069246671 10:66215801-66215823 AGAATGCTGCCCAAGGTGGAAGG + Intronic
1071073526 10:81724791-81724813 AGAGAGCTGCAGGACCTAGATGG + Intergenic
1071867334 10:89749054-89749076 AGAGAGTTTCAAAAGGTGGGAGG - Intronic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1072076193 10:91976486-91976508 AGATAGCTTCAGAAGGGGGCTGG - Intronic
1073085674 10:100887034-100887056 GGAGAGCTGGAGACGGTGGCAGG + Intergenic
1073120907 10:101122137-101122159 AGAGGGCAGCAGCAGGTGGGAGG + Intronic
1073290478 10:102410850-102410872 AGGGAGCTGCTCAAGGTGGGGGG - Exonic
1074404669 10:113170535-113170557 AGAGAGAGGCAGAAGGTGTCTGG - Intergenic
1074721110 10:116265949-116265971 AGAGAACTGCAGAGGGAGGGTGG - Intronic
1075197978 10:120377779-120377801 AGAGAGGAGCAGAAGGGGAAGGG - Intergenic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1075300699 10:121321307-121321329 GAAGAGGTGGAGAAGGTGGAAGG + Intergenic
1075821275 10:125314252-125314274 AGAAAAATTCAGAAGGTGGATGG + Intergenic
1076067308 10:127458886-127458908 AGTGGGCTGCAGAAAGTAGAAGG + Intergenic
1076192562 10:128492968-128492990 AAAGAGATGAAAAAGGTGGAGGG + Intergenic
1076485910 10:130816844-130816866 TGGGAACTGCAGCAGGTGGAGGG - Intergenic
1077059906 11:613526-613548 ACGGTGCTGCAGAAGGTGGTGGG - Exonic
1077532498 11:3103787-3103809 AGAGGGCTGCAGAGGCAGGAAGG - Intronic
1077899677 11:6478550-6478572 ACAGAGGTCCAGAAGTTGGAGGG - Intronic
1077999058 11:7478538-7478560 AGTGAGCTGCAGAAAGTGTTGGG + Intergenic
1078526014 11:12102070-12102092 CGTGAGCTGCAGGAGCTGGAAGG + Intronic
1079970515 11:27030500-27030522 AGAGTGGTGCAGATGGAGGAGGG + Intergenic
1080394313 11:31875902-31875924 AGGAAGCTGCAGAAGGAGGAGGG - Intronic
1080517179 11:33035281-33035303 ACAGAGGTGGAGGAGGTGGAAGG - Intergenic
1080562182 11:33474046-33474068 AGAGAGAGGGAGAAGGTGGCAGG + Intergenic
1080659506 11:34284669-34284691 AGAGAGGTGGAGAAAGCGGAGGG + Intronic
1081571462 11:44294012-44294034 AGAGCTCTGTAGACGGTGGAGGG - Intronic
1081737216 11:45412371-45412393 AGACAGCTCCAGAGGGTGGTGGG - Intergenic
1082866190 11:57902051-57902073 CGACAGCTGCAGAGGGAGGAGGG - Intergenic
1083240565 11:61384848-61384870 AGGGAGCTGCCCCAGGTGGAAGG + Intergenic
1084002003 11:66300982-66301004 AGAGAGGAGCAGATGGTGGTAGG - Intergenic
1085073946 11:73573059-73573081 AAAGAGGTGCAGATGGTGGCTGG - Intronic
1085418678 11:76337192-76337214 AGTGAGCTGCAGAATCTGGGTGG - Intergenic
1085460083 11:76688331-76688353 GGTGAGCAGCAGAAGGTGGCAGG + Intergenic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1086490446 11:87353608-87353630 AGACAGCTACAGAAGGAAGATGG - Intergenic
1086498486 11:87427834-87427856 GGAAAGTTGCAGAAGATGGAGGG + Intergenic
1087070735 11:94077784-94077806 AGAGAGGAACAGAATGTGGATGG - Intronic
1087131638 11:94673859-94673881 AGTGAGCTGCAGATGGTCAATGG - Intergenic
1087430469 11:98047030-98047052 AGAGTGCTGCAGCATGTGAAAGG + Intergenic
1088071224 11:105787736-105787758 AGAGAGCTGATGAAGATGGGGGG + Intronic
1088900446 11:114112403-114112425 TGAGAGATGGAGAAGGTAGAGGG + Intronic
1089363844 11:117909153-117909175 ACAGGGCTGCAGAAGGTGCTGGG + Intronic
1089747798 11:120629159-120629181 GGAGAGGTGGGGAAGGTGGAGGG + Intronic
1090146145 11:124325213-124325235 AGAGAGCTGGAGCAGATGAAGGG + Intergenic
1090481247 11:127070635-127070657 AGCAAGCAGAAGAAGGTGGAAGG - Intergenic
1092564007 12:9646410-9646432 AGAGAGAGTCAAAAGGTGGAAGG + Intergenic
1093396214 12:18685804-18685826 AGAGAGATACAGGAGGAGGATGG - Intronic
1094439561 12:30459585-30459607 AGAGAGCAGAAGAAGTTTGAGGG + Intergenic
1094552863 12:31469449-31469471 AGAGAGGTGCAAAAGGTGTAGGG - Intronic
1095572136 12:43695474-43695496 AGAGAGCTGAAGAAAAGGGATGG + Intergenic
1095598990 12:43993542-43993564 AGAGACTTGGAGAAGATGGAGGG + Intronic
1095948413 12:47766993-47767015 AGACAGCAGCAGCAGGTGGCTGG - Intronic
1096078296 12:48818270-48818292 AGAGAGAGGCAGAGGGAGGACGG - Intronic
1096478033 12:51920665-51920687 AGAGAGATGCAGAGGGAGGTGGG - Intronic
1096680241 12:53251179-53251201 AGAGAACTGGAGGAGGTGGGGGG + Intergenic
1096919381 12:55067878-55067900 AGAGGGCTGCAGACGCTGGGAGG + Intergenic
1097263934 12:57735495-57735517 GGAAAGCTGCAGAGGGAGGAGGG - Intronic
1097513223 12:60568930-60568952 AGACAGATAGAGAAGGTGGAGGG - Intergenic
1099556330 12:84112242-84112264 AGAAAGCTGCAGAATCAGGAAGG - Intergenic
1099622393 12:85020548-85020570 AGAAAACTGCAGAAGCAGGAAGG + Intronic
1100665325 12:96746014-96746036 AGAGAGAGGCAGAAGGAGGCTGG - Intronic
1100717724 12:97323465-97323487 AGAGAACTGCAGAAGCAGGAAGG - Intergenic
1101014451 12:100485115-100485137 ATAGAGCTGCAGAATGTGACTGG - Intronic
1101262888 12:103050925-103050947 AGAAAGCTGCGTAAGGAGGAAGG - Intergenic
1103141542 12:118553066-118553088 TGAGAACTGCAAAAGGGGGAGGG + Intergenic
1103516079 12:121509352-121509374 TAAGAGCTGCAGAGGGTGGGTGG - Intronic
1104722781 12:131054684-131054706 AGAGAGCTGCATGGAGTGGAGGG - Intronic
1104788233 12:131465305-131465327 TGAGAGGTGGAGGAGGTGGAAGG - Intergenic
1104884677 12:132099881-132099903 ACAGAGCTGCAGCAGGGAGAAGG - Intronic
1105974745 13:25463788-25463810 AGAGAGCTAGAGCTGGTGGAAGG + Intronic
1106107249 13:26743248-26743270 AGAGAGATGGAGAAGGGGGCTGG + Intergenic
1106220009 13:27738629-27738651 AAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1107015522 13:35705548-35705570 GGAGAGGTGGAGTAGGTGGAAGG + Intergenic
1107384632 13:39894613-39894635 AGAAAACTGCAGAAGCAGGAAGG - Intergenic
1108503894 13:51091986-51092008 AGAGAGCAGCAGGGGATGGATGG - Intergenic
1108732879 13:53253341-53253363 AGAGAGCAGCAAAAGGGGGCAGG - Intergenic
1109764412 13:66874968-66874990 AGAGATATGTAGAAGGGGGAGGG + Intronic
1109931921 13:69226934-69226956 AGCAAGCAGAAGAAGGTGGAAGG + Intergenic
1110975884 13:81833453-81833475 AGAAAGCTGCAGAAGCCAGAAGG - Intergenic
1110994236 13:82085361-82085383 AAAGGGCTGCAGAAGCTTGATGG + Intergenic
1112471794 13:99695901-99695923 AGAAAACTGCAGAAGTAGGAAGG - Intronic
1112542269 13:100326615-100326637 GGAGAGGTGGAGGAGGTGGAAGG - Intronic
1112554151 13:100451461-100451483 ACAGAGCTGCATTACGTGGATGG + Intronic
1113098956 13:106696348-106696370 AGAGTGCTGCAGCAGTGGGATGG - Intergenic
1114471820 14:22968345-22968367 AGAGAGCTCCAAGTGGTGGAGGG + Intronic
1115113125 14:29848252-29848274 AAAAAGATGCAAAAGGTGGATGG + Intronic
1116349824 14:43847162-43847184 GGAGAACTGCACAAGGTAGAGGG + Intergenic
1117432582 14:55683326-55683348 AAAGAGATGAAGCAGGTGGAGGG - Intronic
1118320316 14:64748917-64748939 AAAGAGCTGGAGAAGGCTGATGG - Exonic
1118758545 14:68863468-68863490 GCAGAGGTGCAGAAGATGGAAGG + Intergenic
1119030248 14:71186771-71186793 AGAGAGATGCAGCATGGGGAAGG + Intergenic
1119996874 14:79262800-79262822 AGAAACCTGGAGAAAGTGGATGG + Intronic
1120442189 14:84555976-84555998 AGAAAGCTGGAAAAGGTGGATGG - Intergenic
1120819942 14:88902821-88902843 ACAGACTTACAGAAGGTGGAGGG + Intergenic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121656371 14:95599258-95599280 GGAGAGCAGTAGAAGCTGGAAGG + Intergenic
1121780780 14:96620747-96620769 GGAGATTTGCAGAAGGTTGAAGG - Intergenic
1122077907 14:99247397-99247419 AGCCAGCTGCTGAAGGTGGCAGG + Intronic
1122876476 14:104668448-104668470 AGAGAGCTGCAGAGGCTGCGAGG + Intergenic
1202904417 14_GL000194v1_random:60079-60101 AGAGAGGAGGTGAAGGTGGAAGG - Intergenic
1123709722 15:22978937-22978959 AGTGAGCTGTAGCAGGTGCATGG - Intronic
1124007454 15:25806158-25806180 AGAGAGGTGGAGGAGGTGGAAGG - Intronic
1124686652 15:31788666-31788688 TGGCAGCTGCAGGAGGTGGAAGG + Intronic
1125516160 15:40322593-40322615 AGAGAGCGGAAGGAGGGGGAGGG + Intergenic
1125594566 15:40876070-40876092 GCAGAGGTGGAGAAGGTGGAAGG + Intergenic
1125967270 15:43884530-43884552 AGAGAGCTGGGGAGGGAGGAAGG - Intronic
1128062900 15:64746562-64746584 GGACAGCTGCAGAGTGTGGATGG + Intronic
1128065884 15:64764172-64764194 AGAAGGCTGCAGGAGGTGGGTGG - Intronic
1128184314 15:65631508-65631530 AGAGATCTGCAGAATGAGAAGGG + Intronic
1128186937 15:65650683-65650705 AGAAAGGTGTAGAAGATGGAGGG + Exonic
1128716809 15:69914521-69914543 AGAGAGAGACAGAAGGAGGAGGG - Intergenic
1129146045 15:73648458-73648480 AGAGGGATGGAGAAAGTGGAGGG - Intergenic
1129457861 15:75685259-75685281 GGAGCCCTGCAGAAGGAGGACGG - Exonic
1129725945 15:77901755-77901777 GGAGCCCTGCAGAAGGAGGATGG + Intergenic
1130887379 15:88105230-88105252 GGAGAGCTGCAGATGGTGCCTGG - Intronic
1131465893 15:92654840-92654862 AGGGAGCTGCAGATGGTAGAAGG + Intronic
1131812823 15:96190430-96190452 GGAGAGCTTCAGCAGGTGGAAGG - Intergenic
1134535003 16:15019249-15019271 AGAAGGGTGCAAAAGGTGGAGGG + Intronic
1134718959 16:16370590-16370612 AGAGAGATGGAGAAAGGGGAGGG - Intergenic
1135809679 16:25576027-25576049 AGAGAGCTGGGGAAGTTGCAGGG - Intergenic
1135920307 16:26643460-26643482 AAAGAGCAGCAGAGGGTGGAGGG - Intergenic
1136066353 16:27761506-27761528 AGAGATCTGGTGCAGGTGGATGG - Exonic
1136120026 16:28126904-28126926 AGAGAACTGAAGTAGGGGGAGGG - Intronic
1138133550 16:54502120-54502142 AGAGAGTTGGAGAAGGTGGGTGG + Intergenic
1138630808 16:58292987-58293009 AGAGAGCTGCAGGAGGCTGAGGG + Intronic
1138795430 16:59962652-59962674 AGGGAGCTGCATCAGTTGGAAGG + Intergenic
1139478644 16:67216045-67216067 AAAGAGCAGGAGAAGGAGGAAGG - Intronic
1139748529 16:69094032-69094054 ACAGAGCTGCAGGAGGCTGAGGG + Intergenic
1139813693 16:69647335-69647357 GCAGAGCTGCAGTATGTGGATGG + Exonic
1140069084 16:71633925-71633947 AGAGAGCGGCAGGAGGATGATGG - Intronic
1140622400 16:76751427-76751449 AGTGAACTGCAGAAGGAGAAGGG + Intergenic
1140661060 16:77191562-77191584 AGGAAGCTAGAGAAGGTGGAGGG + Exonic
1140754688 16:78056701-78056723 AATGAGCTGCAGGAGGTGGGAGG - Intronic
1141348991 16:83275541-83275563 AGAGAGATGGAGAAGATGCAGGG + Intronic
1141519286 16:84566873-84566895 AGCGAGCTGAAGAAGGCGGGGGG - Exonic
1142264771 16:89058605-89058627 AGAGAGCTCCAGAGGGTCAAGGG - Intergenic
1142484621 17:238734-238756 AGAGAGCTGCTGGGGGTGGGAGG - Intronic
1142617583 17:1145476-1145498 CCAGAGCTGCAGAAGGCGGGTGG + Intronic
1143164288 17:4890130-4890152 AGCGAGTTGGAGAAGGAGGAAGG - Intronic
1143668144 17:8376606-8376628 AAAGAGCTGCAGACTGAGGAAGG + Intronic
1143919235 17:10317753-10317775 TGGGAGCTGCAGAAGGTTCAAGG + Intronic
1144330088 17:14215015-14215037 AGAAAGCTGCAGAAGTTTAAAGG - Intergenic
1144656331 17:17039537-17039559 AGAGAGCTGCAGAGGAGAGAGGG - Intergenic
1146289741 17:31598710-31598732 AAGGAGCTCCAGAGGGTGGAGGG + Intergenic
1147165752 17:38592331-38592353 TGAGGGCTGCAGAGGCTGGAAGG - Intronic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147475574 17:40708586-40708608 AGAGGGCAGCAGGAGGTTGAGGG - Intergenic
1147658312 17:42103641-42103663 AGCGACCTGCGGAAGGTGGAGGG - Exonic
1147744893 17:42688938-42688960 ATGGAGCTGCTCAAGGTGGATGG + Exonic
1147807656 17:43143674-43143696 AGAATGCTGCAGAAGGCGCAAGG - Intergenic
1148896833 17:50843773-50843795 TGAGAGCTGCCGAGGGTGGGAGG - Intergenic
1148996450 17:51714469-51714491 AAAGAGCTCCAGAGGGAGGAAGG - Intronic
1151183592 17:72347536-72347558 AGAGGGCTGCAGAGTGTGCAGGG + Intergenic
1151460323 17:74250343-74250365 CGAGGGCTGCACAAGGTGCATGG + Exonic
1151509492 17:74549597-74549619 ACAGACAGGCAGAAGGTGGAGGG - Intergenic
1152066692 17:78115986-78116008 AGTGAGTTGCAGAAGGGGGTCGG - Intronic
1152352001 17:79789518-79789540 TGAGAGCTGCAGAAAGGGGCTGG + Intergenic
1152592891 17:81222475-81222497 AGGGAGGTGGAGAGGGTGGAGGG + Intronic
1152979928 18:267604-267626 GGGGAGCTGCTGAAGGGGGAGGG - Intronic
1153847057 18:9059639-9059661 AGAGGGCTGAAGAAGCTAGAGGG + Intergenic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154240169 18:12646114-12646136 AGAGAGCAGCAGTACATGGATGG - Intronic
1154382320 18:13863607-13863629 AGATTGATGCAGAAGGTGGGTGG - Intergenic
1155078205 18:22381633-22381655 AGAGTCCAGCAGAAGGAGGAAGG - Intergenic
1155867634 18:30985265-30985287 AGAGACCTGAAGAAAGTGAAAGG - Intergenic
1156015351 18:32541062-32541084 AAAGAGCTGGAAAAGCTGGAAGG - Intergenic
1156147863 18:34207986-34208008 TGACACCTGCAGAATGTGGAGGG - Intronic
1156312459 18:35937303-35937325 AGAGAGATGAAAAAGGAGGAGGG + Intergenic
1156398951 18:36723708-36723730 AGAGAGCTGCAGGAGGTTTGGGG - Intronic
1156459490 18:37313769-37313791 ATAGGGCTACAGATGGTGGAGGG + Intronic
1156462158 18:37327226-37327248 AGAGACCTGCAGAGGCTGGTGGG - Intronic
1156957720 18:42988845-42988867 GCAGAGCTGCAAGAGGTGGATGG + Intronic
1157579344 18:48764438-48764460 ACAGAGGTGCAGAAAGTAGAGGG - Intronic
1157918364 18:51691983-51692005 AGAGAGTTGCATCAGGTGAAGGG - Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158776246 18:60583491-60583513 AGAGATCTGAAGCAGGTGGATGG - Intergenic
1159464627 18:68765243-68765265 AAAGAGCTAAAGAAGGAGGAAGG + Intronic
1159518394 18:69487751-69487773 AGAGATCTTCAAAATGTGGAGGG - Intronic
1159756059 18:72367594-72367616 AGAGAGAAGGAGAAAGTGGAAGG + Intergenic
1159883164 18:73878854-73878876 AGACAGCTGCAGAACCTGCAGGG - Intergenic
1159901079 18:74046375-74046397 AGAGAGCAGCAGGAAGTGCACGG + Intergenic
1160045782 18:75386153-75386175 AGAGAGTGGCTGCAGGTGGAGGG + Intergenic
1160427544 18:78788335-78788357 AGAGAGCAGGAGGAGGTGCAGGG - Intergenic
1161895034 19:7073886-7073908 ACAGAGCTGTAGAGGGTGGACGG - Intronic
1162081459 19:8220287-8220309 AGAGGGAGGCTGAAGGTGGAGGG - Intronic
1163732286 19:18956012-18956034 AGGGAGGTTGAGAAGGTGGATGG + Intergenic
1163782394 19:19257394-19257416 AGTGAGATGCAGAAGGTGTACGG + Exonic
1164429292 19:28172808-28172830 AGAGAGCTGGAGGAGGTGCCAGG - Intergenic
1164700328 19:30280216-30280238 AGAGAGGGTCTGAAGGTGGAAGG - Intronic
1164943060 19:32266558-32266580 ATTGAGCTGCAGAACGTGAACGG + Intergenic
1166309003 19:41951972-41951994 AGAGAGATTCAGGAGGTTGAAGG - Intergenic
1167209981 19:48128099-48128121 TGAGAGCTGCAGAAGGAAAAGGG - Intronic
1167262515 19:48467197-48467219 AGGGAGATGGAGAAGCTGGAGGG - Intronic
1167508181 19:49882103-49882125 AAAGAGCTGCAGGTGGTGGAAGG - Exonic
1167786603 19:51643101-51643123 ACAGGGCTGGAGATGGTGGATGG + Exonic
1168189725 19:54729317-54729339 AGAGAGACAGAGAAGGTGGAAGG + Intronic
1168194006 19:54760255-54760277 AGAGAGACAGAGAAGGTGGAAGG + Intronic
1168196052 19:54774990-54775012 AGAGAGACAGAGAAGGTGGAAGG + Intronic
1168725216 19:58577422-58577444 AAAGAACTGCAGAAGGTGAGGGG + Intergenic
1202696819 1_KI270712v1_random:132023-132045 TGAGGGCTGCAGACGGTGGGCGG + Intergenic
925078154 2:1037161-1037183 AGAGAGAAGCAGAAGGCAGATGG - Intronic
925182703 2:1827300-1827322 TGTGATCTGCAGGAGGTGGAAGG - Intronic
925211423 2:2050737-2050759 TGAGAGCGGCAGAAGGTAGCGGG + Intronic
925380465 2:3421877-3421899 GCAGAGCTGCAGAAACTGGAGGG + Exonic
925525215 2:4792881-4792903 AATGAGCTGCACAAGGTAGAGGG - Intergenic
926175598 2:10588921-10588943 ATGGAGGTGCAGAGGGTGGAGGG - Intronic
926249458 2:11145754-11145776 AGAGAGGGGCACAAGATGGAGGG + Exonic
926444458 2:12926329-12926351 AGAGAGAGACAGAAAGTGGAGGG + Intergenic
926679646 2:15653907-15653929 AAAGGGCTGGAGAAGGTGCAGGG - Intergenic
927461840 2:23306073-23306095 GGAGAGATGGAGAAGATGGAAGG + Intergenic
927804144 2:26130546-26130568 AGAAAGCTGAAGCAGGAGGATGG - Intronic
927863185 2:26573233-26573255 AGTGAGCTCCAGAAGGAGGGAGG + Intronic
927882927 2:26701371-26701393 AGGGAAGTGGAGAAGGTGGATGG + Intronic
929113138 2:38422108-38422130 AGAGAGCTGGGGAAAGTGGCTGG - Intergenic
929813956 2:45216122-45216144 AGAGATCTGTAGGAGGTGGGTGG - Intergenic
930052526 2:47227815-47227837 AAATGGCTGCAGAAGGAGGAGGG - Intergenic
930272555 2:49273872-49273894 AGAGAGCTGCCCAAGGTTGTGGG - Intergenic
931023804 2:58084375-58084397 AGAGAGGTGGAGAGGGTGGGAGG - Intronic
931193084 2:60024395-60024417 AGAGATCTTCGAAAGGTGGAGGG - Intergenic
931543324 2:63353687-63353709 AGACACCTGTAGGAGGTGGATGG - Intronic
931707887 2:64962593-64962615 AGCAGGCAGCAGAAGGTGGAAGG - Intergenic
931769585 2:65486196-65486218 AGAAAACAGCAGAAGCTGGAAGG - Intergenic
931908561 2:66869428-66869450 AGGGAACTGCAGAAGGAGTAAGG + Intergenic
932336665 2:70935691-70935713 TGAGAGCTGGAGGATGTGGAGGG - Intergenic
932558959 2:72850680-72850702 TGGGAGCTGAAGGAGGTGGAAGG - Intergenic
932671624 2:73742130-73742152 AGAAAGCTACCGAGGGTGGATGG + Intergenic
932846961 2:75145840-75145862 GGAGAGGTGCAGAAAGTAGATGG + Intronic
932901238 2:75702802-75702824 TGAGAGCTACAGAAGTTAGAAGG + Intronic
933991721 2:87638818-87638840 AGAAAGCTGCAGATGGAAGATGG - Intergenic
934277974 2:91589037-91589059 TGAGGGCTGCAGACGGTGGGCGG + Intergenic
934853714 2:97716562-97716584 AGAGACCTGAATAAAGTGGAAGG + Intronic
935047749 2:99497477-99497499 AGAAAGCTTCAGGAGGTGTAGGG + Intergenic
935525738 2:104164165-104164187 ATAGAACTGCAGAGGGTGAAGGG - Intergenic
935672007 2:105563860-105563882 AGAGAGATATAGAATGTGGAGGG - Intergenic
935976135 2:108580801-108580823 AGAGAGTTTCAGGAGGGGGATGG + Intronic
936302124 2:111312000-111312022 AGAAAGCTGCAGATGGAAGATGG + Intergenic
936644619 2:114354724-114354746 AGGGAGCTACAGAAAGAGGAGGG + Intergenic
936816226 2:116464200-116464222 AGAGAGCCACAGAAGGAAGATGG - Intergenic
937153775 2:119703722-119703744 AGACACCAGCAGAAGATGGAAGG + Intergenic
937417542 2:121728728-121728750 ACAGAGCTGCAGAGGTTGAAGGG + Intronic
937515589 2:122651480-122651502 TGAGAGCTTCAGAGGGTGGCAGG - Intergenic
938150092 2:128875010-128875032 AGAGAACTACAGAAGGTTGGGGG - Intergenic
938969924 2:136422741-136422763 AGGGGCCTGGAGAAGGTGGAAGG + Intergenic
939831626 2:147079559-147079581 ACAGAGGTGGAGAAGATGGAAGG + Intergenic
941060470 2:160841821-160841843 AGAGAGAGGAAGATGGTGGATGG + Intergenic
941200683 2:162505223-162505245 ATAAAGCTGCAGAGGGTGAAAGG + Intronic
942686955 2:178542836-178542858 AGGAAGCAGCAGGAGGTGGACGG + Exonic
944512323 2:200476916-200476938 AGAGAGCTGGAAAATGGGGATGG + Intronic
946439359 2:219681983-219682005 AGAAAGCTGCCCAGGGTGGATGG + Intergenic
946448148 2:219757437-219757459 AGAGAGATGCAGAGTGTGGTGGG + Intergenic
947349835 2:229231981-229232003 TGAGAGCTGCAGCACTTGGAAGG + Intronic
947760530 2:232600489-232600511 AGGGGGCTGCAGAAGGATGATGG - Intergenic
948162460 2:235836323-235836345 AGAGCACTGCAGCAGGTGGCCGG + Intronic
948254305 2:236554778-236554800 AGAGAGATACAGCAGGAGGAAGG - Intergenic
1168821015 20:773937-773959 AGAGGGCAGGAGAATGTGGAGGG - Intergenic
1169048602 20:2558248-2558270 AGAAAACTGCAGAAGCAGGAAGG - Intronic
1169779929 20:9298045-9298067 AGAAAACTGCAGAAGCTGGAAGG + Intronic
1169905550 20:10599723-10599745 AGAGAGTTGAACAAAGTGGAAGG - Intronic
1170505842 20:17024962-17024984 AGAAAGCAGAAGAAGGTGGGAGG + Intergenic
1170890290 20:20369690-20369712 GGCGAGCTGTAGAAGGTGGCCGG - Exonic
1171173910 20:23036994-23037016 AGAGGACTCAAGAAGGTGGAGGG + Intergenic
1171392387 20:24809907-24809929 AGAGAGCGGCTGCAGGTGAAAGG + Intergenic
1171423327 20:25033423-25033445 TGACAGCTGTACAAGGTGGAGGG - Intronic
1171469767 20:25361009-25361031 TGAGAGCTGCGGAAGATGGCTGG - Intronic
1172013612 20:31860780-31860802 AGAGGGGTTCAAAAGGTGGAAGG + Intronic
1172574473 20:35997119-35997141 AAAGATCTGCAGAGGATGGAAGG - Intronic
1173203387 20:40970457-40970479 AGACAGCAGCAGAAGCTGGGAGG + Intergenic
1173257567 20:41405624-41405646 AGAGAGCTGCACAAGTAGGCGGG - Intronic
1173538996 20:43837659-43837681 AAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1173954374 20:47019206-47019228 AGAGAGCTGGAGACGTTGGCTGG - Intronic
1175111915 20:56654418-56654440 AGTGAGATGGAGAAGGTGAAAGG + Intergenic
1175776576 20:61657631-61657653 AAAGATCTACAGAAGTTGGATGG + Intronic
1175813334 20:61870512-61870534 AGGGACATGCAGAAGGTGGAGGG - Intronic
1175884546 20:62281839-62281861 AAAGAACTTCACAAGGTGGAAGG + Exonic
1176511439 21:7751505-7751527 AGAGAGCTGCAGAAGGTGGAAGG + Intronic
1176968287 21:15236425-15236447 AGAAAACTGCAGAAGCAGGAAGG - Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177968587 21:27760011-27760033 GGAGAGATGCTGGAGGTGGAAGG + Intergenic
1178645553 21:34382034-34382056 AGAGAGCTGCAGAAGGTGGAAGG + Intronic
1179345895 21:40556983-40557005 GGAGAGGTGGAGAAGGTGGAAGG + Intronic
1180714021 22:17859279-17859301 AGAGAGCTGCTTCAGGGGGACGG + Intronic
1180727360 22:17956273-17956295 AGACAGTTGCAGAAAGGGGATGG + Intronic
1180735519 22:18013603-18013625 ACAGAGCTGTTGAGGGTGGATGG + Intronic
1181033765 22:20160310-20160332 AGAGGGCTGAAGGAGCTGGAGGG - Intergenic
1181500669 22:23313951-23313973 AAAGAGCTGCAGAAGGCGGTGGG - Exonic
1181574685 22:23786434-23786456 AGAGGAATGGAGAAGGTGGAAGG + Intergenic
1181975593 22:26727103-26727125 ACAGAGGTTCAGAAGGTTGATGG + Intergenic
1182307632 22:29381776-29381798 ACAGAGCTGCAGAAGGTGGGGGG + Intronic
1183371275 22:37433801-37433823 GGAGAGCTGGAGGAGGAGGAAGG + Intergenic
1183512419 22:38243902-38243924 AGGGAGCTGCAGACTGTGGTGGG + Intronic
1183589229 22:38770200-38770222 AGAGAGCTGCTGCTGGTGGCAGG + Intronic
1183784907 22:40023666-40023688 AGAGAGCGGCAGCAGGGGCAGGG - Intronic
1183977791 22:41523324-41523346 ACAGAGCCCCAGAAGTTGGAGGG + Intronic
1184848077 22:47101426-47101448 AGAGAGACGGAGAAGCTGGAAGG - Intronic
1185325107 22:50221702-50221724 AGGGGGCTGCAGCAGGCGGAGGG - Exonic
949122397 3:402417-402439 AGAGAGTAGCAGAAAGGGGAAGG - Intronic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949509519 3:4755979-4756001 TGAGAGCTGCAGATGTTGGCTGG + Intronic
950042663 3:9930220-9930242 AGAGACCGGCACAGGGTGGATGG - Intronic
950667774 3:14507601-14507623 AGCCACCTGCAGGAGGTGGATGG + Exonic
952053250 3:29412352-29412374 AGAGAACTGCAGAAGGAGAAGGG + Intronic
953071510 3:39525429-39525451 AGAATGTTGCAGAATGTGGAGGG + Intronic
953318901 3:41954565-41954587 AGAGAGCTACAATAGGTAGAAGG - Intronic
953339128 3:42119024-42119046 AGAGAGCAGCAGCCGGTGGCAGG - Intronic
953487974 3:43320424-43320446 TGGGAGCTCCAGTAGGTGGAAGG + Intronic
953778773 3:45846778-45846800 AAAGAGTTGGAGGAGGTGGAAGG + Intronic
953857801 3:46514545-46514567 AGAAAACTGCAGAAGCAGGAAGG + Intergenic
954049345 3:47960182-47960204 AGATGGCTGCAGCATGTGGAGGG - Intronic
954363258 3:50133525-50133547 TGAGAGCTCCAGCAGGGGGAGGG - Intergenic
954859809 3:53677950-53677972 AGTGAGCTGAAGAATGTAGAGGG + Intronic
955183925 3:56697065-56697087 ATAGACATGCATAAGGTGGAGGG - Intergenic
955406631 3:58629850-58629872 AGAGAGGAGGAGAAGGAGGATGG + Intergenic
955621622 3:60870478-60870500 AAAGAGATGCAGGAGGTGGAAGG + Intronic
956614047 3:71153204-71153226 AGAGGGCTGCAGGAGCTGGGTGG - Intronic
958080474 3:88740212-88740234 AGAAAGAGGAAGAAGGTGGAGGG - Intergenic
958177614 3:90016650-90016672 AGAGAGCTGGAGAGGCTGGTTGG - Intergenic
958595385 3:96216008-96216030 AGGGAGCTGCAGAAGGGTGGAGG + Intergenic
958799101 3:98735460-98735482 AGAGATGTGCAGAAGATAGAAGG - Intronic
959045872 3:101472912-101472934 AGAGCCTTTCAGAAGGTGGAGGG - Intronic
959849902 3:111072731-111072753 AGAGAGCTCCAGAAGCTGTCAGG - Intronic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960309624 3:116105312-116105334 AGACTGCTGGAGAAGCTGGAAGG - Intronic
960536744 3:118823627-118823649 ATAAAACTGCAGCAGGTGGAGGG + Intergenic
961066362 3:123880585-123880607 GGAGAGGAGCAGAGGGTGGAAGG + Intronic
961514376 3:127423562-127423584 AGAGAGTGGCAGACGGAGGAGGG - Intergenic
962010714 3:131387711-131387733 AGAGACCTGAAGAAGGTGGGAGG - Intronic
962235571 3:133704304-133704326 AGAGAACTACAGTAAGTGGAGGG + Intergenic
962318771 3:134374588-134374610 AGGGAGCGGGAGAAGGCGGAGGG - Intronic
963598939 3:147360602-147360624 AGAATGCTGGAGAAGGTGGTTGG + Intergenic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
964033987 3:152173171-152173193 GAAGAGGTGGAGAAGGTGGAAGG - Intergenic
965163056 3:165160047-165160069 GGAGAGCTGCCCCAGGTGGATGG + Intergenic
965674311 3:171178981-171179003 AGAGGTCTGCACAATGTGGAGGG + Intronic
965951030 3:174308479-174308501 AGCAAGCAGAAGAAGGTGGAAGG - Intergenic
965971242 3:174558896-174558918 ACAGAACTGCAGCAAGTGGAGGG - Intronic
966269262 3:178085014-178085036 AGAGATCTGCAGCAGGAGGCGGG + Intergenic
966525769 3:180917577-180917599 AGATAGTTGCAAAACGTGGAGGG + Intronic
966863348 3:184242611-184242633 GCAGAGCTGCAGGATGTGGAAGG + Exonic
968289233 3:197525906-197525928 AGAGACCTGCAGAGGGAGCACGG - Intronic
968733333 4:2282154-2282176 TGGCAGCTGCAGAAGGTGGCTGG - Intronic
968782350 4:2592745-2592767 AGAGAGCTGCAAAGAGGGGAAGG + Intronic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
969256963 4:6008758-6008780 AGGGAGCTGTTGAAGGTGCAGGG - Intergenic
969436199 4:7191112-7191134 AGAGGGCTGCAGACCGTGGCTGG - Intergenic
969965702 4:10993236-10993258 GCAGAGCTCCAGAAGCTGGAGGG + Intergenic
970505839 4:16729485-16729507 AGAGAGCAGGAGAGGGAGGAGGG + Intronic
970870566 4:20812367-20812389 AGAAAGCTGAAGAGGATGGATGG + Intronic
971213256 4:24640181-24640203 AGAGAGCTGAAGGGTGTGGAGGG - Intergenic
971591238 4:28472228-28472250 AGACACCTTCACAAGGTGGAAGG - Intergenic
971980423 4:33743385-33743407 AGAAAGCTGCCTAGGGTGGATGG + Intergenic
972207357 4:36792052-36792074 GGGGTGCTTCAGAAGGTGGAAGG - Intergenic
973937863 4:55868500-55868522 AGAGAGCTGCAGGTGCTAGATGG + Exonic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
974761726 4:66285322-66285344 ACAGAGCCCCAGAAGGTGGCAGG + Intergenic
974966346 4:68765243-68765265 AGAGACCTTCAGAAGGCAGATGG + Intergenic
974972620 4:68848044-68848066 AGAGACTTTCAGATGGTGGAAGG - Intergenic
975001376 4:69226719-69226741 AGAGACCTTCAGAAGGGAGATGG + Intergenic
975004065 4:69265362-69265384 AGAGACCTTCAGAAGGCAGATGG - Intergenic
975888241 4:78991811-78991833 AGAGAGCAGCAGCAGGAGGCTGG + Intergenic
976131338 4:81887591-81887613 AGAGAGGGGAAGGAGGTGGAAGG + Intronic
977233293 4:94477765-94477787 AAAGAGGTGGAGGAGGTGGAAGG - Intronic
977266890 4:94866182-94866204 AGAGAGCTTGAGAAGATGGATGG - Intronic
977459513 4:97307828-97307850 AGAAAACTGCAGAAGCAGGAAGG - Intronic
977722361 4:100254449-100254471 TGACACCTGCAGAAGGAGGAAGG + Intergenic
978303393 4:107294970-107294992 AGAGACATGGAGAAGGGGGATGG + Intergenic
979038143 4:115751866-115751888 GAAGAGGTGGAGAAGGTGGAAGG + Intergenic
979528345 4:121741128-121741150 AGAAAGCAGCAGCAAGTGGAGGG - Intergenic
979545367 4:121933776-121933798 AGAGAAACGCATAAGGTGGAGGG - Intronic
980970245 4:139560560-139560582 TGACAACTGCAGAAGCTGGAGGG + Intronic
984959850 4:185086187-185086209 AGGGAGCTGCAGATGGCGGAGGG + Intergenic
985528259 5:418763-418785 AGAGAGCTCCAGAAGATGCAGGG + Intronic
986210347 5:5665688-5665710 GAGGAGCTGCAGGAGGTGGAGGG + Intergenic
987071192 5:14338446-14338468 AGGGAGCTCTAGAAGGTGCAAGG - Intronic
988169205 5:27632867-27632889 AGCGATCTGCAGAAGATGGCAGG + Intergenic
989110426 5:37901999-37902021 AGAGAGATGCAGGAGGTCGTTGG + Intergenic
989168022 5:38449448-38449470 AAAGGGCTGAAGAAGGAGGACGG - Intronic
990079757 5:51898923-51898945 GAAGAGGTGGAGAAGGTGGAAGG + Intergenic
990867421 5:60395803-60395825 AGAGAGATGCAGAGCGGGGAGGG - Intronic
990897928 5:60718826-60718848 AAAGAGTTGGAGAAGGTGGAAGG - Intergenic
991036402 5:62131940-62131962 AGGGAGCAGGAGAAGGGGGATGG - Intergenic
992079781 5:73225028-73225050 GGAGAGCTGCAGAAGATTTAGGG + Intergenic
992871193 5:81007193-81007215 GGAAACCTGCAGAAGGTGAAGGG + Intronic
993372609 5:87111182-87111204 AGAGAACTGCAGTAGGGTGAGGG - Intergenic
993607630 5:90013759-90013781 AGAGAGCTGGACATGGTGGAGGG + Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996095062 5:119389694-119389716 AAAGAGCTTCAGATGGTGGAGGG + Intronic
996408929 5:123135593-123135615 AGGGAGTTGCAGGGGGTGGAGGG - Intronic
996570132 5:124924733-124924755 AGAGGGGTACTGAAGGTGGAAGG + Intergenic
997143452 5:131407221-131407243 AGAGAGCTGCAAGAGGTGACTGG + Intergenic
997225740 5:132208372-132208394 AGAGAGGAGGAGAAGGGGGAGGG + Intronic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
998392280 5:141795110-141795132 TGAGGTCTGCGGAAGGTGGATGG - Intergenic
999289535 5:150414759-150414781 AGAGAGCTTCAGATGGAGGCTGG + Intergenic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999625562 5:153517020-153517042 AGAGAGAGGCAGGAGGTGGGAGG + Intronic
999774794 5:154803584-154803606 AGAGAGCGGGCGATGGTGGAGGG - Exonic
1000034364 5:157432339-157432361 AGAAAGGTGGAGGAGGTGGAAGG - Intronic
1000657413 5:163897168-163897190 AGAGAGCTGGTGATGGTGGGTGG - Intergenic
1000918135 5:167106747-167106769 ATAGAGGTGAAGAGGGTGGAGGG + Intergenic
1001590198 5:172859584-172859606 AGAGAGCTGCCGCAGGTGCCTGG + Intronic
1001663542 5:173413989-173414011 AAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1001960121 5:175874956-175874978 AGAAAGCTGGAAAAGGTGGGGGG + Intronic
1002159285 5:177305536-177305558 CCAGAGCTGCAGCTGGTGGAAGG + Intronic
1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG + Intronic
1002930772 6:1633604-1633626 AGAGATCTGCACAATGTGCACGG + Intronic
1003174416 6:3744527-3744549 AGTGAGATGGGGAAGGTGGAGGG + Intronic
1003221133 6:4161971-4161993 ACAGGGCTCAAGAAGGTGGAAGG - Intergenic
1003425315 6:5994926-5994948 AGACAGCTCCAGAGGATGGACGG + Intergenic
1003469924 6:6420103-6420125 AGTTACCTGCAGATGGTGGAAGG + Intergenic
1003643925 6:7899033-7899055 AGAGGGCTGCAGGTGGTGGAGGG + Intronic
1003812993 6:9805229-9805251 AGGGAGATGGAGAAGGGGGAGGG - Intronic
1004926638 6:20422254-20422276 AGGAAGCTGCAGAGGTTGGAAGG - Intronic
1005103628 6:22200027-22200049 ACAGAGGAGCAGAGGGTGGAGGG - Intergenic
1005775903 6:29130439-29130461 TGAGATATGCAGAAAGTGGAGGG - Intergenic
1005920066 6:30393353-30393375 AGAGAGGTAAAGAAGGTGGTGGG + Intergenic
1006183579 6:32168086-32168108 AGAGAGCTGAAGAAAGGGGGAGG + Exonic
1006251055 6:32785693-32785715 AGAATGCTGCAGATGGTGGCAGG + Intergenic
1006932159 6:37695059-37695081 AGAAGGCTGGAGAAGCTGGAGGG + Intronic
1007183098 6:39944914-39944936 AGCAAGGTGCAGAAGATGGAGGG - Intergenic
1007307903 6:40921488-40921510 AGAGCCCTGCAGAGGGAGGAAGG + Intergenic
1007391573 6:41552405-41552427 TGGGAGCTGGAGAAGCTGGATGG + Intronic
1009777546 6:68224141-68224163 AGAAAACTGCAGAAGCGGGAAGG - Intergenic
1010807138 6:80250556-80250578 GGAGAGCTGAGGAAGGTGGGAGG + Intronic
1011356403 6:86476558-86476580 AGAAAGCTCCAGAAACTGGAGGG + Intergenic
1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG + Intergenic
1012526052 6:100178965-100178987 TGAGAGCTGCAGAACATGGCTGG - Intergenic
1012969056 6:105707042-105707064 AAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1013226370 6:108121660-108121682 AGAGATGGGCAGAAGCTGGAAGG - Intronic
1013236950 6:108205532-108205554 AGAGAGGTGGAGGAGGTGGAAGG - Intergenic
1013363008 6:109411885-109411907 AGAGGGCTGCAGAAGGGTGAAGG - Intronic
1014600973 6:123411698-123411720 AGATACCTGCAGATGGTAGAGGG - Intronic
1014743939 6:125177607-125177629 AATGTGCTGCAGAAGGTGAAGGG - Intronic
1015018392 6:128442288-128442310 AGGGAGCTGCAAAAGGAGGTAGG - Intronic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015824834 6:137300625-137300647 AGAGAACAGCAGAAGCAGGAAGG - Intergenic
1016045275 6:139474478-139474500 TGAGAGCTTTAGAAGGGGGAAGG - Intergenic
1017444450 6:154494689-154494711 AGAGGGTGGCAGAGGGTGGAAGG - Intronic
1017654802 6:156617434-156617456 AGTGAGCAGCGGAAGATGGATGG - Intergenic
1018205927 6:161436879-161436901 ACAGAGCTGCAGAGGGTGACCGG - Intronic
1018944789 6:168340004-168340026 AGTGAGCTGCAGGAAGTGGAAGG - Intergenic
1019208764 6:170386710-170386732 AGAGAGCAGAAGAAGAAGGAAGG + Intronic
1019258012 7:63969-63991 AGAGGGCTGCAGGAAGAGGAAGG - Intergenic
1019432583 7:1006143-1006165 AGAGACCCACAGAAAGTGGAGGG + Intronic
1022388591 7:29924440-29924462 AGACAGCAGCAGAGGCTGGAGGG - Intronic
1023115693 7:36859890-36859912 AGAGAGGTGGAAGAGGTGGAAGG - Intronic
1024104344 7:46067032-46067054 AGAGAGATGAAGAATGGGGAGGG - Intergenic
1024135757 7:46406459-46406481 AGAGAAGGGCAGAGGGTGGATGG - Intergenic
1024325982 7:48109556-48109578 CTAGAGCTTGAGAAGGTGGAAGG - Intergenic
1024930605 7:54664102-54664124 AGAGAGCTACAGACGGGTGACGG + Intergenic
1024961435 7:54980922-54980944 AGAGAGAGGCATAAGGAGGAAGG + Intergenic
1025212220 7:57026270-57026292 GGTGAGCTGCAGAGGGAGGATGG + Intergenic
1025659734 7:63550558-63550580 GGTGAGCTGCAGAGGGAGGATGG - Intergenic
1026098662 7:67367009-67367031 TTAGAGATGCAGAAGGTAGAAGG + Intergenic
1027782983 7:82542708-82542730 AGATAGCTGGAGAAGGTTGAAGG - Intergenic
1028307704 7:89286923-89286945 AAAGAAGTGGAGAAGGTGGAAGG - Intronic
1028621790 7:92834904-92834926 AGATAGCTGCTGAATGGGGAGGG - Intronic
1028988923 7:97028624-97028646 AGAGAGCCGCAGAAGGGGGTGGG + Intergenic
1029057114 7:97758304-97758326 AGAAAACTGCAGAAGCAGGAAGG - Intergenic
1029675399 7:102065036-102065058 GGTGAGCTGCAGAGGGAGGATGG + Intronic
1030007776 7:105135434-105135456 AGAGAGCAGCAGCAGAGGGAAGG + Intronic
1030767742 7:113432467-113432489 AGAGAGATGCAGAAGGTGGAGGG - Intergenic
1031209787 7:118808363-118808385 AAAGAGATGGAGGAGGTGGAAGG + Intergenic
1031769418 7:125824357-125824379 AGAGAGCAGGAGACGGTGGAGGG + Intergenic
1031958502 7:127967174-127967196 AGAGTGCTGGAGAAGGCAGAAGG + Intronic
1032548997 7:132766886-132766908 GGTGAGCTGCAGCAGGAGGAGGG + Intergenic
1033399461 7:141008064-141008086 AGAGATCTGCAAAAGAGGGAGGG - Intronic
1034105924 7:148489836-148489858 AGTGAGCTGCCTAAGGTGGCTGG - Intergenic
1034248708 7:149670980-149671002 AGAGAGTTGCAGAAGCAGCAAGG - Intergenic
1034263808 7:149772261-149772283 GGAGAGCTGCAGAAGGGAGGGGG - Intronic
1034283654 7:149870500-149870522 AGAGAGCTCCAGAAGTAGGCAGG + Intergenic
1034632982 7:152545109-152545131 AGAGAGCTGCACCCCGTGGAAGG - Intergenic
1034924875 7:155113155-155113177 AGAAAACTGCAGACAGTGGAAGG + Intergenic
1036155085 8:6334072-6334094 AGCGAGCTGTATAAGGAGGAAGG + Intergenic
1036587731 8:10140331-10140353 AGAAAGCAGCAGAAGCAGGAAGG - Intronic
1036645476 8:10609356-10609378 AGAGAGCTCCAGAAGCTCCAGGG - Exonic
1037939542 8:22941343-22941365 AGACAGGTGCAGAAGGTTGGAGG + Intronic
1038394516 8:27237041-27237063 CGAGAGGGGCAGAAGGTGGCAGG + Intronic
1039809051 8:41028348-41028370 TGAGAGGTGCAGGAGGTAGAAGG - Intergenic
1043779944 8:84320319-84320341 AGAGAGCAAGAGAAGGTAGAAGG - Intronic
1044106101 8:88209204-88209226 GAAGAGGTGCAGGAGGTGGAAGG - Intronic
1044485494 8:92748286-92748308 AGAAAGATGCAGTAGCTGGAGGG + Intergenic
1044916035 8:97113305-97113327 AGAGAGCAGCAGCAGGAGAAGGG + Intronic
1046552561 8:115734849-115734871 AGAAAGCTGCAAAAAGTAGAGGG - Intronic
1046612909 8:116445311-116445333 GGGGAGGGGCAGAAGGTGGAGGG + Intergenic
1047557180 8:125944983-125945005 AGAAAGCTGTAGAAGGTTCATGG + Intergenic
1048975095 8:139667017-139667039 TGAGAGCTGGACAGGGTGGACGG - Intronic
1049350724 8:142163161-142163183 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350754 8:142163332-142163354 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350784 8:142163468-142163490 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350828 8:142163722-142163744 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350857 8:142163893-142163915 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350898 8:142164081-142164103 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350914 8:142164170-142164192 AGAGAGATGAAGATGGAGGATGG + Intergenic
1049350932 8:142164257-142164279 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049365416 8:142234635-142234657 AGGGAGCTGCAGAGGCTGGAGGG - Intronic
1049516151 8:143057957-143057979 AGAGAGATGCAGAGGGAGGGAGG - Intronic
1049699804 8:144005252-144005274 GATGAGCTGCTGAAGGTGGATGG + Intronic
1050493343 9:6213301-6213323 AGAGAGCTGCTGAAGCACGAAGG + Intergenic
1051490140 9:17654093-17654115 AGAGAGCTGCAGACTGGGGGAGG + Intronic
1052258902 9:26491812-26491834 AGAGAGCTGCAGCTGGGGGAGGG - Intergenic
1052968769 9:34363625-34363647 AGAGAGCAGCAGCAGGGGGAAGG - Intergenic
1053052627 9:34974492-34974514 AGACAGCTGCAGAATGTGGGAGG - Intronic
1053352708 9:37424136-37424158 ACTGAGCAGGAGAAGGTGGAAGG + Intronic
1053826560 9:42030694-42030716 AGACAGCTGCAGGTGGGGGAAGG - Intronic
1054604000 9:67156703-67156725 AGACAGCTGCAGGTGGGGGAAGG + Intergenic
1055107035 9:72523680-72523702 GTAGAGGTGCAGGAGGTGGAAGG + Intronic
1055111529 9:72564736-72564758 AGAGAGCTGGAGTGTGTGGAAGG - Intronic
1055122011 9:72671369-72671391 AGAAAACTGCAGAAGCAGGACGG - Intronic
1055517437 9:77047377-77047399 AAAGAGCTGCAGTAGGGGCAGGG + Intergenic
1055807585 9:80114169-80114191 AGGGATCAGCTGAAGGTGGAAGG + Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056821989 9:89848948-89848970 AGAAAGCTGCAGCAGGAGGAAGG - Intergenic
1056924957 9:90826602-90826624 CCAGAGCTGTAGAAGCTGGAAGG - Intronic
1057114499 9:92507766-92507788 AGAGAGGTGTGAAAGGTGGAGGG - Intronic
1058580200 9:106447540-106447562 AAAGAGGTGGAGAAGGTGGAAGG - Intergenic
1058594687 9:106602769-106602791 AGAGAGCTGCCAAAGGCTGAAGG - Intergenic
1058634501 9:107023364-107023386 AGGGAGCTGGTGAGGGTGGATGG + Intergenic
1059158919 9:112015184-112015206 AGAGGGCTGTAGAAGGAAGAGGG + Intergenic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059408389 9:114116560-114116582 ACAGAGCTGCAGAGGATGGATGG - Intergenic
1059894996 9:118853958-118853980 AGAGAGCTCTAGAAGATGGATGG + Intergenic
1062114766 9:134802426-134802448 TTAGAGCTGCAGAACGGGGAGGG + Intronic
1062583456 9:137238227-137238249 CGACAGCTGCAGGAGGAGGAGGG + Intergenic
1185764555 X:2715111-2715133 GAAGAGCTGCAGAAGAAGGAAGG - Intronic
1185779008 X:2829448-2829470 GGAGAGGTGCAGAGCGTGGAGGG + Intronic
1186060987 X:5706878-5706900 AGAGAGCTAGATATGGTGGATGG - Intergenic
1186540337 X:10393654-10393676 AGAGTAATGCTGAAGGTGGATGG - Intergenic
1186553926 X:10536942-10536964 AGAGAGCTAGAGAAGGTGTAAGG + Intronic
1186596309 X:10985357-10985379 AGAGACTTGAAGAATGTGGAGGG - Intergenic
1187365016 X:18659704-18659726 AGAAAACTGCAGAAGCAGGAAGG + Intronic
1187377669 X:18770587-18770609 AGTGTGTTGCATAAGGTGGATGG + Intronic
1188642252 X:32520924-32520946 AGAGAGCTGCAGAAAGAGGATGG - Intronic
1188967140 X:36568413-36568435 AGAAAGCTGCACATGGTGGTTGG + Intergenic
1190626511 X:52343068-52343090 AGAGAGAGGCAGAAAGGGGAAGG + Intergenic
1190806706 X:53844683-53844705 AGAGAGCTGCAGTAGAAGTAGGG - Intergenic
1192050371 X:67719025-67719047 AGAGGGCTGAAGAGGGGGGAAGG - Intronic
1192225488 X:69224508-69224530 AGAGAGCTTGAGAAGGTGGCAGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1195246289 X:102998545-102998567 AGAGTGCTGAACCAGGTGGAAGG - Intergenic
1195676659 X:107511982-107512004 AGAGAATTCCAGAAGGTGGAGGG - Intergenic
1196144792 X:112304843-112304865 AGAGAGATGCAGGAGTGGGATGG - Intergenic
1197703951 X:129620408-129620430 TCAGAGCTGCAGAACGTGGGTGG - Intergenic
1197705050 X:129628921-129628943 AGAGAGCAGGAGTAGGAGGATGG + Intergenic
1197753668 X:129981298-129981320 AGATGGCTGAAGAAGGGGGAAGG - Intronic
1198079641 X:133227274-133227296 GTACAGCTACAGAAGGTGGATGG + Intergenic
1198921892 X:141738373-141738395 TGAGAGGAGCAGAAAGTGGAGGG - Intergenic
1199780346 X:151052427-151052449 AGAGAGAGGAAGCAGGTGGAAGG - Intergenic
1199904203 X:152207722-152207744 AGAGTGGTGCAGAAGGTGAAGGG - Intronic
1201277752 Y:12314455-12314477 TGAAAGCTTCAGAAGTTGGAAGG + Intergenic
1201357641 Y:13113762-13113784 TGAAAGCTTCAGAAGTTGGAAGG + Intergenic
1202052641 Y:20796981-20797003 TGAAAGCTTCAGAAGTTGGAAGG - Intergenic