ID: 1178649718

View in Genome Browser
Species Human (GRCh38)
Location 21:34411781-34411803
Sequence GCCATGGGCCCTGTGTGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178649711_1178649718 13 Left 1178649711 21:34411745-34411767 CCACAGCCTCTCTGGGGCTGTGT No data
Right 1178649718 21:34411781-34411803 GCCATGGGCCCTGTGTGCCATGG No data
1178649710_1178649718 18 Left 1178649710 21:34411740-34411762 CCACACCACAGCCTCTCTGGGGC No data
Right 1178649718 21:34411781-34411803 GCCATGGGCCCTGTGTGCCATGG No data
1178649713_1178649718 7 Left 1178649713 21:34411751-34411773 CCTCTCTGGGGCTGTGTCCTGGA No data
Right 1178649718 21:34411781-34411803 GCCATGGGCCCTGTGTGCCATGG No data
1178649717_1178649718 -10 Left 1178649717 21:34411768-34411790 CCTGGAGGCGTGTGCCATGGGCC No data
Right 1178649718 21:34411781-34411803 GCCATGGGCCCTGTGTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178649718 Original CRISPR GCCATGGGCCCTGTGTGCCA TGG Intergenic
No off target data available for this crispr