ID: 1178658305

View in Genome Browser
Species Human (GRCh38)
Location 21:34483701-34483723
Sequence CTAAATATACAAATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178658305_1178658309 4 Left 1178658305 21:34483701-34483723 CCATTGTCCATTTGTATATTTAG No data
Right 1178658309 21:34483728-34483750 TTGGGAGAAAAAAGCCGAAAAGG No data
1178658305_1178658310 15 Left 1178658305 21:34483701-34483723 CCATTGTCCATTTGTATATTTAG No data
Right 1178658310 21:34483739-34483761 AAGCCGAAAAGGAGATTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178658305 Original CRISPR CTAAATATACAAATGGACAA TGG (reversed) Intergenic
No off target data available for this crispr