ID: 1178661673

View in Genome Browser
Species Human (GRCh38)
Location 21:34511834-34511856
Sequence CTGCAGAAGCACATGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178661673_1178661678 -7 Left 1178661673 21:34511834-34511856 CCCTTCTCCATGTGCTTCTGCAG No data
Right 1178661678 21:34511850-34511872 TCTGCAGTTGGAAGAAGTGAGGG No data
1178661673_1178661677 -8 Left 1178661673 21:34511834-34511856 CCCTTCTCCATGTGCTTCTGCAG No data
Right 1178661677 21:34511849-34511871 TTCTGCAGTTGGAAGAAGTGAGG No data
1178661673_1178661680 -5 Left 1178661673 21:34511834-34511856 CCCTTCTCCATGTGCTTCTGCAG No data
Right 1178661680 21:34511852-34511874 TGCAGTTGGAAGAAGTGAGGGGG No data
1178661673_1178661679 -6 Left 1178661673 21:34511834-34511856 CCCTTCTCCATGTGCTTCTGCAG No data
Right 1178661679 21:34511851-34511873 CTGCAGTTGGAAGAAGTGAGGGG No data
1178661673_1178661681 -4 Left 1178661673 21:34511834-34511856 CCCTTCTCCATGTGCTTCTGCAG No data
Right 1178661681 21:34511853-34511875 GCAGTTGGAAGAAGTGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178661673 Original CRISPR CTGCAGAAGCACATGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr