ID: 1178661678

View in Genome Browser
Species Human (GRCh38)
Location 21:34511850-34511872
Sequence TCTGCAGTTGGAAGAAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178661674_1178661678 -8 Left 1178661674 21:34511835-34511857 CCTTCTCCATGTGCTTCTGCAGT No data
Right 1178661678 21:34511850-34511872 TCTGCAGTTGGAAGAAGTGAGGG No data
1178661671_1178661678 -5 Left 1178661671 21:34511832-34511854 CCCCCTTCTCCATGTGCTTCTGC No data
Right 1178661678 21:34511850-34511872 TCTGCAGTTGGAAGAAGTGAGGG No data
1178661668_1178661678 25 Left 1178661668 21:34511802-34511824 CCTCATTTTAGGAGGTGGGCAAC No data
Right 1178661678 21:34511850-34511872 TCTGCAGTTGGAAGAAGTGAGGG No data
1178661672_1178661678 -6 Left 1178661672 21:34511833-34511855 CCCCTTCTCCATGTGCTTCTGCA No data
Right 1178661678 21:34511850-34511872 TCTGCAGTTGGAAGAAGTGAGGG No data
1178661667_1178661678 26 Left 1178661667 21:34511801-34511823 CCCTCATTTTAGGAGGTGGGCAA No data
Right 1178661678 21:34511850-34511872 TCTGCAGTTGGAAGAAGTGAGGG No data
1178661673_1178661678 -7 Left 1178661673 21:34511834-34511856 CCCTTCTCCATGTGCTTCTGCAG No data
Right 1178661678 21:34511850-34511872 TCTGCAGTTGGAAGAAGTGAGGG No data
1178661669_1178661678 3 Left 1178661669 21:34511824-34511846 CCCTTTCTCCCCCTTCTCCATGT No data
Right 1178661678 21:34511850-34511872 TCTGCAGTTGGAAGAAGTGAGGG No data
1178661670_1178661678 2 Left 1178661670 21:34511825-34511847 CCTTTCTCCCCCTTCTCCATGTG No data
Right 1178661678 21:34511850-34511872 TCTGCAGTTGGAAGAAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178661678 Original CRISPR TCTGCAGTTGGAAGAAGTGA GGG Intergenic
No off target data available for this crispr