ID: 1178661692

View in Genome Browser
Species Human (GRCh38)
Location 21:34511947-34511969
Sequence TAGAATTCCCCTGACCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178661684_1178661692 9 Left 1178661684 21:34511915-34511937 CCTCAAGGTGACCTTGCCGCATG No data
Right 1178661692 21:34511947-34511969 TAGAATTCCCCTGACCAGGGTGG No data
1178661683_1178661692 10 Left 1178661683 21:34511914-34511936 CCCTCAAGGTGACCTTGCCGCAT No data
Right 1178661692 21:34511947-34511969 TAGAATTCCCCTGACCAGGGTGG No data
1178661686_1178661692 -2 Left 1178661686 21:34511926-34511948 CCTTGCCGCATGGCCTGAACCTA No data
Right 1178661692 21:34511947-34511969 TAGAATTCCCCTGACCAGGGTGG No data
1178661687_1178661692 -7 Left 1178661687 21:34511931-34511953 CCGCATGGCCTGAACCTAGAATT No data
Right 1178661692 21:34511947-34511969 TAGAATTCCCCTGACCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178661692 Original CRISPR TAGAATTCCCCTGACCAGGG TGG Intergenic
No off target data available for this crispr