ID: 1178661838

View in Genome Browser
Species Human (GRCh38)
Location 21:34513407-34513429
Sequence GACCATAACCTACCACAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178661838 Original CRISPR GACCATAACCTACCACAGAC AGG Intronic
901121646 1:6899202-6899224 CACTATAACCTAGCACACACTGG - Intronic
904414560 1:30350222-30350244 TGCCATAAAATACCACAGACTGG + Intergenic
905725896 1:40251814-40251836 GACCATAAGCTGCCATAGATGGG + Intergenic
909687450 1:78366394-78366416 GACCATACCCAACCACAAACTGG - Intronic
910763531 1:90758488-90758510 AACCCTGACCTACAACAGACAGG - Intergenic
911233431 1:95384422-95384444 GATCATAACCTAACACAGGTAGG - Intergenic
916301375 1:163278197-163278219 GACCATAATGTGCCTCAGACAGG - Intronic
1070407036 10:76106260-76106282 GACCATACCATACCCCAAACTGG - Intronic
1073331188 10:102670834-102670856 GTCCAGAACCAACCACACACAGG - Intergenic
1074327521 10:112466768-112466790 GACAACAAAGTACCACAGACTGG + Intronic
1079768440 11:24425710-24425732 GACCATAACCCATCACGAACAGG - Intergenic
1082971686 11:59029537-59029559 GACCAAAATGTAACACAGACAGG + Intronic
1084666293 11:70578069-70578091 GACCACAACGCCCCACAGACTGG - Intronic
1084738618 11:71122911-71122933 TGCCATAACCAACCACAGACTGG - Intronic
1084889478 11:72229657-72229679 CCCCAGAACCTGCCACAGACAGG + Exonic
1088916198 11:114229776-114229798 TACCAGGACCTAACACAGACTGG + Intronic
1099977790 12:89564453-89564475 TGCCATAAAATACCACAGACTGG + Intergenic
1102970289 12:117161079-117161101 GAGCAGCAGCTACCACAGACTGG + Intronic
1104188686 12:126457540-126457562 GACCCTAACCTGGCACACACAGG + Intergenic
1106260577 13:28062958-28062980 TACAACAAACTACCACAGACTGG - Intronic
1107386729 13:39918426-39918448 GACCATCACATACCAGAGAATGG + Intergenic
1109056105 13:57551479-57551501 GACCATAACCAACTTCAAACAGG + Intergenic
1109619064 13:64877242-64877264 GACCAGAACCCACCCTAGACAGG + Intergenic
1110250132 13:73372082-73372104 GACCAGATCTCACCACAGACTGG - Intergenic
1114215119 14:20652150-20652172 CATCATAAAATACCACAGACAGG + Intergenic
1116583089 14:46667538-46667560 GACCATAACTTTCCACATACAGG + Intergenic
1116700557 14:48236468-48236490 GACCATAAGCAAGCACAGCCAGG + Intergenic
1118404273 14:65408330-65408352 GCCCACAACCCACTACAGACTGG + Intergenic
1122358147 14:101136586-101136608 GGCCATGAGCTCCCACAGACAGG - Intergenic
1127546670 15:59999545-59999567 GACCTTAACTCATCACAGACAGG - Intergenic
1129039564 15:72674424-72674446 GAGCATAATATACCACAGACAGG + Intergenic
1129305166 15:74655497-74655519 GGCCATATCCTACCAGATACAGG + Intronic
1130567549 15:85009609-85009631 CAAGATAACCTACCACAGTCCGG - Intronic
1135813748 16:25613321-25613343 GATAAAAACATACCACAGACTGG + Intergenic
1137241501 16:46658721-46658743 GACTATGACATACCACAGAATGG + Exonic
1141324005 16:83038515-83038537 CATCATGACCTTCCACAGACAGG - Intronic
1141864315 16:86739791-86739813 GAACATAAAGTGCCACAGACCGG + Intergenic
1145093641 17:20006353-20006375 GATCATAACTTACCACAAAATGG + Intergenic
1149224256 17:54450385-54450407 GTCAATAAAATACCACAGACTGG - Intergenic
1157601635 18:48896775-48896797 GCCCCGAACCTACCACAGCCCGG + Intergenic
1158328279 18:56333389-56333411 GACCATAATCTCCCATGGACTGG - Intergenic
1159516279 18:69462594-69462616 GACCAAAATCTAGCACAAACAGG - Intronic
1164579915 19:29428695-29428717 GACCATAACCCACCAGGAACAGG + Intergenic
1164605229 19:29593205-29593227 CACAATAAAATACCACAGACAGG + Intergenic
926419818 2:12685579-12685601 AAACATAAACTACCACAAACTGG - Intergenic
928200021 2:29241876-29241898 GACCATAGCCAGCCACTGACTGG - Intronic
929490095 2:42388464-42388486 TGCCATAAAATACCACAGACTGG + Intronic
931495381 2:62800715-62800737 GACCATATCCTGCCACATATAGG + Intronic
933412093 2:81939660-81939682 GACCATAATCTCCCACAGAAAGG + Intergenic
933836653 2:86251341-86251363 CACCACAACATCCCACAGACTGG + Intronic
936990820 2:118363986-118364008 GACCATACCATACCAGAGAGGGG + Intergenic
938157131 2:128951381-128951403 GAGCACAACCTACCACAGTTGGG + Intergenic
940592304 2:155744915-155744937 TACCATAATATACCAGAGACTGG - Intergenic
941699649 2:168590775-168590797 AAACAGAACCTACCACAGATGGG - Intronic
948358434 2:237399284-237399306 CACCATACCCTACCTCAGGCAGG + Intronic
948437226 2:237961913-237961935 TGCCATAAAATACCACAGACTGG - Intergenic
1169407199 20:5331749-5331771 GTTCATAACAGACCACAGACTGG + Intergenic
1170388947 20:15851316-15851338 CATCATAAAGTACCACAGACTGG + Intronic
1171183017 20:23104941-23104963 GAACAGAAACTACCAGAGACAGG + Intergenic
1174425928 20:50431462-50431484 GCCCTTAACCAACCACTGACAGG + Intergenic
1177292075 21:19126626-19126648 GGCCACAAAATACCACAGACTGG + Intergenic
1177834606 21:26174252-26174274 TGCCATAACTTACCATAGACTGG + Intergenic
1178661838 21:34513407-34513429 GACCATAACCTACCACAGACAGG + Intronic
1181438003 22:22921499-22921521 GACCTTAGCCTTCGACAGACAGG - Intergenic
1182802408 22:33042228-33042250 TATAATAAACTACCACAGACTGG - Intronic
1185393144 22:50573353-50573375 CAGCATAACCTACCTCTGACGGG - Intronic
949550829 3:5111466-5111488 GAACATAGCCTAGCACAGTCCGG - Intergenic
950582897 3:13874187-13874209 GACCAGAAACTGCCACAGGCTGG - Intronic
953029909 3:39172607-39172629 GACCTTAGCCCACCACAGTCAGG + Intergenic
960601461 3:119463202-119463224 GACCACAAACTTCAACAGACTGG + Intronic
963259218 3:143176509-143176531 GACCATCACCGACCAGAGCCTGG + Intergenic
966522905 3:180892944-180892966 CACCACATCCTATCACAGACGGG + Intronic
966816949 3:183897081-183897103 GACCATAACCGACCCCATCCTGG - Intergenic
974225687 4:59039766-59039788 CATGATAAACTACCACAGACTGG - Intergenic
979524960 4:121706879-121706901 AACCACATCATACCACAGACTGG + Intergenic
982408478 4:155046057-155046079 GATAACAAACTACCACAGACTGG - Intergenic
983745677 4:171196523-171196545 CACAATAAACTGCCACAGACTGG - Intergenic
984445772 4:179833675-179833697 GACAATAGCCTTCCAGAGACTGG + Intergenic
984760766 4:183360801-183360823 CACCATGAAATACCACAGACGGG - Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
986463004 5:7992688-7992710 TACCATAACATACCACAGACTGG + Intergenic
992646410 5:78815864-78815886 AACCATAAACTACCACAGATGGG - Intronic
993350378 5:86842974-86842996 CACAAGAACATACCACAGACTGG + Intergenic
1003961927 6:11216706-11216728 CACCATAGCTTACCAAAGACCGG - Intronic
1004700031 6:18070049-18070071 GCCGATAAAGTACCACAGACTGG + Intergenic
1005104322 6:22206894-22206916 CATCATAAAATACCACAGACTGG - Intergenic
1005588816 6:27303509-27303531 AACCATAACATACCAAAGATAGG + Intronic
1006187528 6:32189711-32189733 GACCATCACCGACCAGAGCCTGG - Exonic
1006595399 6:35189500-35189522 GTCCCTAACAGACCACAGACAGG - Intergenic
1006595470 6:35190080-35190102 GTCCCTAACAGACCACAGACAGG + Intergenic
1012282029 6:97339187-97339209 GACCATAAGCTACTAGAGGCAGG + Intergenic
1012352047 6:98264003-98264025 TATAATAAACTACCACAGACTGG + Intergenic
1016724333 6:147344453-147344475 CACCACAAAATACCACAGACTGG + Intronic
1018390055 6:163335344-163335366 CAACATAAATTACCACAGACTGG - Intergenic
1028391797 7:90325645-90325667 GTCCTTAACAGACCACAGACTGG - Intergenic
1035088761 7:156286414-156286436 TACCATAGACTACCATAGACTGG - Intergenic
1036705079 8:11040538-11040560 AAACAAAACCTACCACAGCCTGG + Intronic
1041600461 8:59711570-59711592 TGCCATAAAATACCACAGACTGG - Intergenic
1042952276 8:74213523-74213545 TACCATAAAATACCATAGACTGG + Intergenic
1051024502 9:12590906-12590928 GACCATAACTTACCAAACATTGG + Intergenic
1057189116 9:93076443-93076465 AACCATTGCCTCCCACAGACTGG - Intronic
1188970020 X:36603833-36603855 GACCATAACATAACACATATTGG + Intergenic
1190037603 X:47040253-47040275 GTCCGCAACCTGCCACAGACAGG + Intronic
1190630290 X:52379487-52379509 CATCAAAAACTACCACAGACTGG - Intergenic
1194539822 X:95156591-95156613 CACCATAATCTCCCTCAGACTGG + Intergenic
1201143357 Y:11046821-11046843 TGCCGTAACCAACCACAGACTGG - Intergenic
1201555425 Y:15261313-15261335 GACCATCACCTATCACTGAAAGG + Intergenic