ID: 1178662591

View in Genome Browser
Species Human (GRCh38)
Location 21:34520050-34520072
Sequence GTCCTAAACCCTGAGCTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178662591_1178662595 23 Left 1178662591 21:34520050-34520072 CCAGAAAGCTCAGGGTTTAGGAC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1178662595 21:34520096-34520118 TCCTGTTGGTTGAAAAGCACAGG 0: 1
1: 0
2: 2
3: 15
4: 184
1178662591_1178662593 9 Left 1178662591 21:34520050-34520072 CCAGAAAGCTCAGGGTTTAGGAC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1178662593 21:34520082-34520104 CAAAATCTCCGCAATCCTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178662591 Original CRISPR GTCCTAAACCCTGAGCTTTC TGG (reversed) Intronic
904822006 1:33251598-33251620 ATCCTAAACCCTTACCTATCTGG + Intergenic
908731091 1:67226921-67226943 GTCCTATATCCTGTGCTTTGGGG - Intronic
921284095 1:213593566-213593588 GTCCTAAACAGTGAACTGTCAGG + Intergenic
921553498 1:216568462-216568484 GTCCTACACATTGAGCTTTCAGG - Intronic
921623004 1:217347044-217347066 GTGATAAAACCTGAGATTTCAGG - Intergenic
922670926 1:227508295-227508317 GGCCTAAAGCCTGCCCTTTCTGG + Intergenic
922745604 1:228041736-228041758 GTGCTAAACCATGTGCTTTTGGG - Intronic
923437749 1:233983948-233983970 ATCCTAGTTCCTGAGCTTTCCGG - Intronic
1063666024 10:8061210-8061232 GTCTTAACGCCTGGGCTTTCGGG + Intronic
1063874707 10:10461916-10461938 TTCCTAAACACTGAAATTTCTGG - Intergenic
1065384421 10:25120101-25120123 CTCCTATATCCTAAGCTTTCTGG - Intergenic
1068063689 10:52101999-52102021 ATGCTAAACCCTAAGCCTTCAGG + Intronic
1068139398 10:52986330-52986352 GTCATAAACACTTAGCTTTCAGG - Intergenic
1069828502 10:71268724-71268746 AGCCTTAACCCTGGGCTTTCAGG + Intronic
1073446313 10:103582543-103582565 GGCCCACACCCAGAGCTTTCTGG + Intronic
1074947364 10:118294195-118294217 GTTCTAACCCCAGAGCCTTCAGG - Intergenic
1075435935 10:122441791-122441813 CAACTAAACTCTGAGCTTTCTGG + Exonic
1077085213 11:746901-746923 GTCCTAAGCCCAGAGGTGTCCGG - Intergenic
1078706254 11:13746920-13746942 GTCCCAAAGCCTGAGGTGTCTGG + Intergenic
1079002544 11:16770092-16770114 GGCCTATAAACTGAGCTTTCAGG - Intergenic
1079226790 11:18613797-18613819 ATCCTAAACACTGATCCTTCAGG - Intronic
1083275660 11:61595610-61595632 CTCCTGAGCCCAGAGCTTTCTGG + Intergenic
1084121313 11:67070640-67070662 GACCTACACCCTGAGCGTTCTGG - Intronic
1086126232 11:83351303-83351325 GGCCTACAGCCTGAACTTTCGGG + Intergenic
1090188170 11:124751720-124751742 TTCCCAAAACCTGAGGTTTCCGG + Intronic
1090667585 11:128924961-128924983 GTCCTCAACCCTGTCCTTTAAGG + Intergenic
1097970269 12:65625882-65625904 GTCCTGAACCCTTCGTTTTCTGG - Intergenic
1101644808 12:106621439-106621461 TTCCTAAAGCCTGGCCTTTCTGG + Intronic
1106099420 13:26681629-26681651 GTCCCAAACCCTCAAGTTTCTGG + Intronic
1110114909 13:71801286-71801308 GTACTAAACTCTGACATTTCTGG - Intronic
1110712736 13:78667420-78667442 TTCCTAATCCCTTAGCTTTCGGG - Intergenic
1111446760 13:88355968-88355990 TTCCTAAACCCTGTGATTCCAGG + Intergenic
1114049946 14:18914296-18914318 GTCCTCAAGCCTGTGCTTCCGGG + Intergenic
1114112611 14:19487634-19487656 GTCCTCAAGCCTGTGCTTCCGGG - Intergenic
1114581472 14:23764353-23764375 GTCCTAAAACCTAGGCTTTTTGG - Intergenic
1114929982 14:27454279-27454301 TTCCTAAACTCTGAGCTTGAGGG - Intergenic
1119562516 14:75602405-75602427 GTTCTAATCCCTGGTCTTTCTGG + Intronic
1202916766 14_GL000194v1_random:182121-182143 GGCCTGAACCCTGAACTTTTGGG - Intergenic
1128393141 15:67196760-67196782 GTCCTACTCCCTGAACTTCCCGG + Intergenic
1128479572 15:68025613-68025635 ATCCTACATCCTGAGCTTCCTGG - Intergenic
1128648720 15:69395334-69395356 GATTTAAACCCTGGGCTTTCTGG - Intronic
1133574279 16:7073092-7073114 CTCCTAAAGTCTGATCTTTCTGG - Intronic
1134452213 16:14370474-14370496 TTCCTCCACCCTGAGCTTCCTGG - Intergenic
1136021720 16:27444781-27444803 ACCCTAAGCCCTGAGCTTTCTGG + Intronic
1139522436 16:67491941-67491963 GTCCCACACCCTTAGCTTCCTGG + Intergenic
1147891675 17:43721731-43721753 GTCTTAAACACTCAGCTTTCTGG + Intergenic
1148735290 17:49861674-49861696 TTCCAAAACCCTGGGCTTCCTGG + Intergenic
1153456785 18:5291611-5291633 TTCCTGAACCCTGAGCGTTGTGG + Exonic
1155406771 18:25497173-25497195 TTCCTAAACCCAGAGCACTCTGG - Intergenic
1158090637 18:53708806-53708828 GTCCTAAACTTTCAGCCTTCAGG - Intergenic
1158588453 18:58760449-58760471 GTCCCAATTCCTCAGCTTTCAGG + Intergenic
1160367846 18:78344000-78344022 TTCCTAAACCGTGTCCTTTCGGG - Intergenic
1162365595 19:10247216-10247238 GTCCTCAAGCCTTAGCTCTCAGG + Intergenic
1164597017 19:29536939-29536961 GTCTAAACCCCTGAGCTTTCTGG + Intronic
1165507778 19:36245394-36245416 GTCGTAAGCGCGGAGCTTTCCGG - Intronic
1167424033 19:49420553-49420575 GTCCTGAGCCCTGAGCTCCCAGG + Intergenic
925853663 2:8108609-8108631 GTCCTAAAACTTTAGCTTTTTGG - Intergenic
928403985 2:31000187-31000209 TCCCTAAACCCTGAGTGTTCTGG + Intronic
931288466 2:60852106-60852128 GTCTTGAACCCTGAGCTTAAGGG + Intergenic
933999291 2:87693194-87693216 GCCCTAAACCCTGGGCTTATAGG + Intergenic
936294560 2:111257697-111257719 GCCCTAAACCCTGGGCTTATAGG - Intergenic
938468263 2:131536700-131536722 GTCCTCAAGCCTGTGCTTCCGGG + Intergenic
940361299 2:152799089-152799111 ATCCTGATCCCTGAGTTTTCAGG - Intergenic
948156513 2:235787874-235787896 GTTCTAGACCATGAGCATTCTGG + Intronic
948167138 2:235871661-235871683 TTCTTAAACCCTGAAGTTTCAGG - Intronic
949027355 2:241772813-241772835 GACCTAAACCCCGAGCGCTCAGG - Intergenic
1169218773 20:3808532-3808554 GTCCTACATCTTGAGCTTTGTGG - Intergenic
1176637302 21:9258448-9258470 GTCCTGAACCCTGAACTTGTGGG + Intergenic
1178662591 21:34520050-34520072 GTCCTAAACCCTGAGCTTTCTGG - Intronic
1180468428 22:15636672-15636694 GTCCTCAAGCCTGTGCTTCCGGG + Intergenic
1182922254 22:34090645-34090667 TTCCAAAAACCTGAGCTTACTGG - Intergenic
1183894619 22:40958216-40958238 TTCCAAAACACTGAGCTTACAGG + Intronic
952035498 3:29196082-29196104 AGCCTGAACCCTGAGTTTTCTGG + Intergenic
956304040 3:67804822-67804844 GCCCCAAACACTCAGCTTTCAGG + Intergenic
957431934 3:80121596-80121618 GTCCTCAGCCCTGAGTTATCTGG + Intergenic
959864085 3:111246232-111246254 TTCCTAAAGCCTGTTCTTTCAGG - Intronic
961158901 3:124705508-124705530 CTCCTAATACCTGAGCTTTTGGG - Intronic
964893634 3:161567421-161567443 TTTCTAAACCCTGTGTTTTCTGG + Intergenic
966851000 3:184164980-184165002 GCCCTAAACCCTGAGGATGCGGG + Intronic
968269832 3:197394879-197394901 TTCCCAAAACCTCAGCTTTCAGG - Intergenic
1202749592 3_GL000221v1_random:146571-146593 GTCCTGAACCCTGAACTTGTGGG - Intergenic
970163124 4:13209328-13209350 CTGCAAAACCCAGAGCTTTCTGG + Intergenic
970192265 4:13528101-13528123 GACCAAAGCCCTGAGCTCTCCGG - Intergenic
972352049 4:38244908-38244930 GTGATAAAGCCTGAGCTTTAGGG - Intergenic
976675879 4:87702955-87702977 CTCCTAAATCATGATCTTTCTGG + Intergenic
977342060 4:95771550-95771572 GTCCCTACCCCTGTGCTTTCAGG - Intergenic
980003790 4:127518050-127518072 GTCATAAACCTTGAGGTTTAGGG - Intergenic
984214610 4:176894630-176894652 TTCCTAAACTCTAACCTTTCAGG + Intergenic
985532474 5:442380-442402 GTGCTAAACCACGAGCGTTCAGG - Exonic
986233350 5:5886192-5886214 GTTTTAAAACCTGACCTTTCAGG - Intergenic
987078674 5:14406850-14406872 GACCTGAACCCTGAGGATTCAGG + Intronic
989960817 5:50412833-50412855 TTTCTAAAGCCTGAGATTTCAGG + Intronic
992157152 5:73966865-73966887 GGCTTAAACCCTTAGCCTTCTGG - Intergenic
995235367 5:109823327-109823349 GTCCCAAACCCTGAACATTAGGG + Intronic
997243663 5:132327867-132327889 ATCCTCAAGCCTGTGCTTTCAGG - Intronic
998046308 5:138989859-138989881 GTCAGAAACTCTGAGTTTTCAGG - Intronic
998784025 5:145689621-145689643 GTCCTATCCCCAGAGCTGTCAGG - Intronic
1000459504 5:161497279-161497301 CTCCCAAACCCTGATCTTTAAGG + Intronic
1003870868 6:10402057-10402079 GCACATAACCCTGAGCTTTCAGG + Intronic
1007935695 6:45730030-45730052 GTCTTAATCCCTGAGATTTAAGG + Intergenic
1013945776 6:115720451-115720473 GTCTTCAACCCTGAGGGTTCTGG - Intergenic
1023439802 7:40173547-40173569 GTCCCTTACCCTGTGCTTTCAGG + Intronic
1025734650 7:64136263-64136285 ATCCTAGCCGCTGAGCTTTCAGG + Intronic
1029676088 7:102069944-102069966 CTCCTAGACCCTGAGCTTCTGGG + Intronic
1033003913 7:137539289-137539311 TAACTAAACCCTTAGCTTTCTGG + Intronic
1033335123 7:140445631-140445653 GTCCTAAACCTCAAGATTTCAGG - Intergenic
1034976404 7:155451267-155451289 GTCTTCAAGCCTGAGCTTTCAGG + Intergenic
1036022658 8:4863088-4863110 ATCCTAGCCACTGAGCTTTCCGG - Intronic
1037762231 8:21749093-21749115 GTCCTAAGCCCTGAGAATACAGG - Intronic
1038441074 8:27571275-27571297 GTCCCAGACTCTGAGCTTTTTGG + Intergenic
1039760390 8:40568436-40568458 GTTCTAAACCCTGAGCAGGCCGG + Intronic
1042010352 8:64237673-64237695 GTCATAAACCCTGAGACTGCAGG - Intergenic
1043552443 8:81389977-81389999 GTCATAGCCACTGAGCTTTCTGG + Intergenic
1053062627 9:35043923-35043945 GACCTCAACCCAGAGCTCTCTGG + Exonic
1055591552 9:77820347-77820369 AACCTGAACCCTGACCTTTCAGG + Intronic
1059890750 9:118799566-118799588 GACTTAAACCCTGAGTTTTAAGG + Intergenic
1061934577 9:133850256-133850278 GCCCTTAACCCTGAGCCTCCGGG + Intronic
1203718234 Un_KI270742v1:176659-176681 GTCCTGAACCCTGAACTTGTGGG - Intergenic
1203652455 Un_KI270751v1:140356-140378 GGCCTGAACCCTGAACTTTTGGG - Intergenic
1188048312 X:25453384-25453406 AGCCTAAAACCTGAGTTTTCAGG + Intergenic
1188261825 X:28032593-28032615 GCCCTAAATCACGAGCTTTCTGG + Intergenic
1188795050 X:34453632-34453654 GTACTAAAATATGAGCTTTCTGG + Intergenic
1188797495 X:34484017-34484039 GTCCTGGACCCTGGGTTTTCTGG + Intergenic
1190430286 X:50372102-50372124 GTCCTCAACCCTAAGCTGTAGGG - Intronic
1192131412 X:68555125-68555147 TTCCTAAAGTCTCAGCTTTCTGG - Intergenic
1201270071 Y:12245861-12245883 ATCTTAAAATCTGAGCTTTCAGG - Intergenic