ID: 1178666295

View in Genome Browser
Species Human (GRCh38)
Location 21:34549914-34549936
Sequence CAGACCCAGGTGAAGTTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 207}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178666293_1178666295 -6 Left 1178666293 21:34549897-34549919 CCAGGAGGCACTGAACACAGACC 0: 1
1: 0
2: 2
3: 29
4: 221
Right 1178666295 21:34549914-34549936 CAGACCCAGGTGAAGTTCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 207
1178666291_1178666295 6 Left 1178666291 21:34549885-34549907 CCCAGACAGACTCCAGGAGGCAC 0: 1
1: 0
2: 2
3: 17
4: 182
Right 1178666295 21:34549914-34549936 CAGACCCAGGTGAAGTTCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 207
1178666289_1178666295 9 Left 1178666289 21:34549882-34549904 CCACCCAGACAGACTCCAGGAGG 0: 1
1: 1
2: 0
3: 37
4: 258
Right 1178666295 21:34549914-34549936 CAGACCCAGGTGAAGTTCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 207
1178666285_1178666295 25 Left 1178666285 21:34549866-34549888 CCCAGAGATGACCATGCCACCCA 0: 1
1: 0
2: 1
3: 18
4: 145
Right 1178666295 21:34549914-34549936 CAGACCCAGGTGAAGTTCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 207
1178666286_1178666295 24 Left 1178666286 21:34549867-34549889 CCAGAGATGACCATGCCACCCAG 0: 1
1: 0
2: 3
3: 11
4: 165
Right 1178666295 21:34549914-34549936 CAGACCCAGGTGAAGTTCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 207
1178666287_1178666295 14 Left 1178666287 21:34549877-34549899 CCATGCCACCCAGACAGACTCCA 0: 1
1: 0
2: 2
3: 32
4: 351
Right 1178666295 21:34549914-34549936 CAGACCCAGGTGAAGTTCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 207
1178666292_1178666295 5 Left 1178666292 21:34549886-34549908 CCAGACAGACTCCAGGAGGCACT 0: 1
1: 0
2: 0
3: 15
4: 194
Right 1178666295 21:34549914-34549936 CAGACCCAGGTGAAGTTCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178666295 Original CRISPR CAGACCCAGGTGAAGTTCTG AGG Intronic
900319538 1:2075763-2075785 CAGACCCCGTGGAAGGTCTGGGG - Intronic
900499897 1:2998953-2998975 CGGACCCTGGTGAACTTCTAGGG + Intergenic
900608956 1:3536414-3536436 GAGCCCCAGCTGAAGCTCTGGGG + Intronic
901733266 1:11295691-11295713 CAGATTCAGGGGAAGTGCTGAGG + Intronic
901766338 1:11502295-11502317 CAGACCCAGGTGAAGGATGGTGG + Intronic
902878995 1:19358554-19358576 CAGACCCAGGTCAACTACTGTGG + Intronic
903624174 1:24719422-24719444 CAGGCCCAGGTCAGGTGCTGGGG - Intergenic
903677743 1:25075091-25075113 CAGAGCCAGGGGATGTTCTGGGG - Intergenic
904901163 1:33858162-33858184 CAGATGCTGGTGAAGTTCTATGG + Intronic
905212155 1:36381784-36381806 CAGTCCCAGTTCAAGTTCTAAGG + Intronic
906855576 1:49300849-49300871 CATACCAAAGTGAAGTTATGAGG - Intronic
908143928 1:61217587-61217609 CAGATCCAGCTGAAGTCCTGTGG - Intronic
911825108 1:102473474-102473496 TTGAACAAGGTGAAGTTCTGTGG - Intergenic
912550788 1:110483950-110483972 AACACCAAGGTGAACTTCTGGGG - Intergenic
912796588 1:112697118-112697140 CAGTCCCAGATGAAGTTTTCAGG + Intronic
913706050 1:121424015-121424037 CATAATCAGATGAAGTTCTGTGG - Intergenic
917600259 1:176566577-176566599 GAGACTCTGGTGTAGTTCTGGGG + Intronic
918231555 1:182537983-182538005 AAAACCCAGGTCAAGTTCAGTGG - Intronic
919438927 1:197602001-197602023 CATACCCAGCTGAATGTCTGTGG - Intronic
920227948 1:204451428-204451450 CAGCCCTGGGTGAAGATCTGTGG - Intronic
920415128 1:205794521-205794543 CAGAGCCATGTGGAGCTCTGTGG + Intronic
924777453 1:247119848-247119870 AAGAGCCAGAAGAAGTTCTGTGG + Intergenic
1062905824 10:1178836-1178858 CAGAACCCGGTGAGGCTCTGTGG - Exonic
1064534716 10:16346752-16346774 CAGACAGAGGGGAAGGTCTGAGG - Intergenic
1064952018 10:20863210-20863232 CATACCCAGGTGCAGTTATGAGG - Intronic
1065608042 10:27441382-27441404 CAGACCCAGGTGAAGGCAAGGGG + Intergenic
1067291329 10:44945437-44945459 CTGACCCAGAAGAAATTCTGAGG - Intergenic
1071534060 10:86413039-86413061 CAGCCCCGGATGATGTTCTGAGG - Intergenic
1072319907 10:94239166-94239188 AATACCAAGCTGAAGTTCTGAGG + Intronic
1072788262 10:98299449-98299471 CAGACCCAGCTCAAGGTCTGAGG + Intergenic
1073033248 10:100545088-100545110 CAGAGCCAGGTGAGCTTGTGTGG + Exonic
1073324153 10:102632866-102632888 CAGACTCAGCTGCAATTCTGAGG + Exonic
1075596373 10:123732582-123732604 CAGTCCCATGGGAAGTTCTGGGG + Intronic
1075910715 10:126123501-126123523 CAGGCTCAGGCCAAGTTCTGGGG + Intronic
1076135047 10:128039955-128039977 GAGTGCCAGGTGAAGATCTGAGG + Intronic
1076404737 10:130204077-130204099 CAGGCCCAGGGGAAGTCCTCGGG - Intergenic
1081620774 11:44618153-44618175 CTTGCCCAGGTGAAGTGCTGCGG + Exonic
1082037337 11:47655981-47656003 CTGAAGCAGGTGGAGTTCTGAGG + Intergenic
1083367675 11:62151314-62151336 CAGGCCCTGGTGCAGTGCTGAGG - Intronic
1083934606 11:65863713-65863735 GAGACCCAGGTGAAGGGCCGTGG + Exonic
1086329587 11:85740252-85740274 CAGAGTCAGGTGAGTTTCTGGGG - Intronic
1088715593 11:112546496-112546518 CAGACCCAGGTCATGTGCTTGGG + Intergenic
1088720459 11:112587786-112587808 CTGACAGAGGTGAAGTTCCGGGG + Intergenic
1089816600 11:121182302-121182324 CACTCCCATGTGAAGCTCTGGGG - Intronic
1091581096 12:1790317-1790339 GATACCCAGGTGATGTTATGTGG + Intergenic
1092120074 12:6037682-6037704 CACCCCCAGGTGAAGGACTGTGG + Intronic
1092137627 12:6160777-6160799 CACACCCAAGTGAAATGCTGAGG + Intergenic
1093099635 12:15012284-15012306 CAGAACTATATGAAGTTCTGAGG - Intergenic
1094470087 12:30795450-30795472 CAGACCCGGGTGGTGGTCTGGGG + Intergenic
1095487393 12:42699288-42699310 GAGAACTAAGTGAAGTTCTGTGG + Intergenic
1095570231 12:43675749-43675771 CTGACCTTGGTGAAGTTCTGGGG - Intergenic
1096429129 12:51528932-51528954 GAGAACCAGGAGAGGTTCTGAGG + Intergenic
1100503319 12:95195341-95195363 TAGAACCTGGTGAAGTCCTGTGG - Intronic
1100730485 12:97462203-97462225 CAGACACTGGTGCAGTACTGGGG + Intergenic
1100871988 12:98919527-98919549 CAGACCCAGCTTAAGAACTGAGG - Intronic
1101597254 12:106178214-106178236 CAAAGGCAGGTGAAATTCTGAGG + Intergenic
1103453052 12:121043155-121043177 GAGACCCAGGTGGAGATATGTGG + Intergenic
1103584318 12:121940357-121940379 CCTTCCCAGGTGAATTTCTGGGG + Intronic
1104989093 12:132615037-132615059 CAGACCCAGCAGAAGCTCTCGGG + Intergenic
1107006794 13:35620866-35620888 CAGAGGCAGGTGAAGGGCTGGGG + Intronic
1107381829 13:39864686-39864708 CATACCTAGGTGAAAATCTGGGG - Intergenic
1108264094 13:48687184-48687206 CAGAACCAGGTGTAATTCTCAGG - Intronic
1113838547 13:113345963-113345985 CAGACCCAGGAGGACTTTTGTGG + Intronic
1113838652 13:113346435-113346457 CAGACCCAGGAGGACCTCTGTGG + Intronic
1113838680 13:113346555-113346577 CAGACCCAGGAGGACCTCTGTGG + Intronic
1113838828 13:113347179-113347201 CAGACCCAGGAGGACCTCTGTGG + Intronic
1113838835 13:113347209-113347231 CAGACCCAGGAGGACCTCTGTGG + Intronic
1113838890 13:113347447-113347469 CAGACCCAGGAGGATCTCTGTGG + Intronic
1113838916 13:113347565-113347587 CAGACCCAGGAGGACCTCTGTGG + Intronic
1114503154 14:23187013-23187035 GGGGCCCAGGTGAAGTCCTGTGG - Intronic
1119941159 14:78643204-78643226 CAGCCCCAGGTAAATTTCTTAGG - Intronic
1125616731 15:41020943-41020965 CAGAGCCAGCTGGAGGTCTGTGG - Exonic
1125897675 15:43316203-43316225 CAGACACAGGTGGAGTCCTAGGG - Intergenic
1128824118 15:70694530-70694552 CAGAACCCAGAGAAGTTCTGAGG - Intronic
1130545870 15:84857464-84857486 CAGCCCCAGGTGCAGTGTTGGGG - Exonic
1132037146 15:98493970-98493992 CAGACCCAGGCTATGTGCTGTGG + Intronic
1132146885 15:99434543-99434565 CAGGCACAGTTCAAGTTCTGAGG - Intergenic
1133274171 16:4626508-4626530 CTGAGCCAGGTGTGGTTCTGAGG - Intronic
1135538576 16:23312875-23312897 CAGAACCTGGTGAAGAGCTGTGG + Intronic
1138448157 16:57077645-57077667 CAGACCCAGCAGATGTGCTGGGG + Intronic
1138556500 16:57774001-57774023 AAGACCCAGGTGAAAGGCTGGGG + Intronic
1138720161 16:59070659-59070681 CAGATCCAGTTGAACATCTGGGG + Intergenic
1139926550 16:70491015-70491037 CAGGTCCAGGATAAGTTCTGAGG + Intronic
1139948996 16:70660232-70660254 CAGACCCAGTTGAACTCCTGTGG - Exonic
1140223910 16:73063964-73063986 CGCGCCCAGGTGACGTTCTGGGG + Intergenic
1140829479 16:78738013-78738035 CAGAGCCCGGTGGACTTCTGTGG + Intronic
1141303942 16:82843452-82843474 CCGACCCAGGGGAAGATATGTGG + Intronic
1142400167 16:89854436-89854458 CAGCCCCAGGTGAAGCTCCACGG - Intronic
1144621963 17:16823654-16823676 CTGGCCCAGGAGATGTTCTGGGG + Intergenic
1144884460 17:18449060-18449082 CTGGCCCAGGAGATGTTCTGGGG - Intergenic
1144886640 17:18467473-18467495 CAGTCCCAGGAGAATTCCTGAGG - Intergenic
1145145572 17:20476835-20476857 CAGTCCCAGGAGAATTCCTGAGG + Intergenic
1147573933 17:41587988-41588010 CTGGCCCAGGAGATGTTCTGGGG + Intergenic
1147648011 17:42045471-42045493 CAGACCCAGATGACTCTCTGTGG + Intronic
1147971972 17:44223007-44223029 CAGAAACACGTGCAGTTCTGGGG - Intergenic
1148481192 17:47960465-47960487 CAGTCCCAGGTGCAGGTGTGAGG + Intergenic
1150005306 17:61465388-61465410 CACACACAAGTGAAGTTCTGGGG - Intronic
1150234991 17:63585758-63585780 CACAACCAGGCAAAGTTCTGTGG - Intronic
1152022975 17:77790747-77790769 CAGGCCCAGGTGAAGGTGTGGGG + Intergenic
1157797048 18:50584271-50584293 CAGACCTATGGGATGTTCTGGGG + Intronic
1157828306 18:50832617-50832639 CACACCCAGGAGATGTGCTGTGG + Intergenic
1159028394 18:63207299-63207321 CACAGCCAGGTGCAGTTTTGTGG - Intronic
1159532443 18:69671848-69671870 CATATCCAGGTGCAGTTCTAGGG + Intronic
1160414293 18:78697300-78697322 CAGACCCAGGTGGAGTTGACAGG - Intergenic
1160723602 19:608168-608190 CAGTACCAGGAGAAGGTCTGAGG + Exonic
1163261157 19:16190831-16190853 CAGACCCAAGTGGGGTACTGGGG - Intronic
1164912688 19:32025595-32025617 TAGGCCCAGCTGAAGGTCTGCGG - Intergenic
1166704434 19:44900892-44900914 CAGACCCAGGAGGAGTCCAGGGG - Intronic
1166862261 19:45817227-45817249 CAGGCCCAGGCTAAGTGCTGCGG + Intronic
1167349096 19:48963818-48963840 CTGAGCCAGGTCTAGTTCTGAGG + Intergenic
925787764 2:7449446-7449468 CTGACACAGGAGAAGTCCTGGGG - Intergenic
927001819 2:18803443-18803465 CAGTGCCAGGTGGAGTTCTCAGG - Intergenic
927158995 2:20240962-20240984 CAGCCCCAGGTGGTGTGCTGTGG + Intergenic
927841014 2:26444114-26444136 CAAACCCAGGAGCAGATCTGTGG - Intronic
927877324 2:26666958-26666980 CAGACTCTGGTGCAGCTCTGAGG - Intergenic
928815010 2:35283126-35283148 CAGAAGCAGTTGAACTTCTGTGG + Intergenic
929459295 2:42090325-42090347 CAATCCCAGCTGAAGTGCTGTGG + Intergenic
931515474 2:63048511-63048533 CGGACCCAGGTCAGGTGCTGAGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
935705424 2:105852313-105852335 GTGGCCCAGGGGAAGTTCTGTGG + Intronic
937888408 2:126916121-126916143 CAGACCCACATGACGCTCTGAGG + Intergenic
938551245 2:132384277-132384299 GAGACCCACGTGCAGTTGTGGGG + Intergenic
938749287 2:134313475-134313497 CATACAGAGGTGAAGTTTTGGGG + Intronic
939562910 2:143752760-143752782 CAGACCCACAGGAAGCTCTGGGG + Intronic
939595610 2:144118963-144118985 CAGACCCTGAGTAAGTTCTGGGG - Intronic
942002717 2:171664930-171664952 CAGACACAGGAGAAAGTCTGTGG + Intergenic
942421404 2:175811817-175811839 CAGACACATGTGGAGTGCTGGGG + Intergenic
944134324 2:196381649-196381671 CAGACCCAGCTGAGGTTATAAGG + Intronic
945357637 2:208857924-208857946 CACACCCACATGAAGTGCTGTGG - Intergenic
947285342 2:228507719-228507741 CAAATCCTGGTGAAGTTTTGTGG + Intergenic
947362268 2:229358247-229358269 GAGACCCAGATTAATTTCTGTGG - Exonic
948262040 2:236611704-236611726 CAGACCCAGGGCAAGTCATGAGG + Intergenic
948326575 2:237126642-237126664 CAGCCCCTGGTGAGGGTCTGTGG - Intergenic
1169252586 20:4071909-4071931 CTGATCCAGGGGAAGCTCTGGGG + Intronic
1170508239 20:17051007-17051029 CAGACACAGGCAAAATTCTGTGG - Intergenic
1171415571 20:24978247-24978269 CAGACCCAATTCTAGTTCTGAGG + Intronic
1174131163 20:48344191-48344213 CAGACCCAGGGGAAATGTTGCGG - Intergenic
1174842444 20:53912735-53912757 CAGCCCCAAGTGAAGTTCAAAGG + Intergenic
1175182057 20:57155688-57155710 CACACCCAAGTCAGGTTCTGGGG + Intergenic
1175515746 20:59568742-59568764 CAGACACAGGTGACCCTCTGGGG - Intergenic
1175621433 20:60450917-60450939 TAGACCCAGGTGACTTCCTGTGG + Intergenic
1178666295 21:34549914-34549936 CAGACCCAGGTGAAGTTCTGAGG + Intronic
1178717018 21:34974435-34974457 CAAAACCAGGTGAAGCTTTGTGG + Intronic
1179891119 21:44335541-44335563 GAGGCCCAGGTGAGGCTCTGAGG + Intronic
1182103716 22:27674349-27674371 CAGCCCCAGGTAAGGTCCTGAGG + Intergenic
1185177060 22:49333916-49333938 CAGAGCCACGTGAGGCTCTGGGG - Intergenic
949895259 3:8763529-8763551 CTGACCCTGGGGCAGTTCTGAGG - Intronic
950416228 3:12870318-12870340 CAGGCCCAGGAAGAGTTCTGGGG - Intronic
952856036 3:37771574-37771596 CGGGCCCCAGTGAAGTTCTGTGG - Intronic
953417797 3:42732882-42732904 CATACCTAGGTGAGGTCCTGTGG + Exonic
953988415 3:47463768-47463790 CAGACACTGTTAAAGTTCTGGGG - Intronic
956020196 3:64925811-64925833 CAGGCCCAGGTGAAGCTTTGTGG - Intergenic
960650953 3:119949390-119949412 AAGAACCATGTGAAGATCTGAGG + Intronic
962191458 3:133315407-133315429 CAGACCCAGGTGTGGTCCTCAGG - Intronic
962201338 3:133403370-133403392 CAGGACCAGGAGGAGTTCTGTGG - Intronic
962981288 3:140492755-140492777 CAGACACAGCTCTAGTTCTGGGG - Intronic
963154189 3:142078166-142078188 CAGACCCAGGTAGATTTCTAAGG + Intronic
964213158 3:154250344-154250366 AAGCCCCAGGGGAAGTCCTGTGG + Intronic
965516818 3:169630320-169630342 CAAACCAAGGTGACTTTCTGAGG - Intronic
966236012 3:177702363-177702385 CAGACCCAGGTGTAGTTTGAAGG + Intergenic
966313406 3:178619107-178619129 CAGACACAGTTTAGGTTCTGAGG + Intronic
970268731 4:14319411-14319433 CAGGCCTAGTTGCAGTTCTGAGG + Intergenic
973155208 4:46943269-46943291 CAGAAACAGCTGAAGTTTTGTGG - Intronic
975823851 4:78299383-78299405 CTGACACAGGAGAAGGTCTGGGG - Intronic
978375084 4:108066497-108066519 GAGACCCAGGTGGTGCTCTGGGG - Intronic
981128246 4:141131935-141131957 CAGACCCAAGGGCAGTGCTGTGG + Intronic
991249298 5:64542277-64542299 CAGGACAAGGGGAAGTTCTGGGG - Intronic
994011618 5:94910890-94910912 CAGGCTCAGATGAACTTCTGTGG + Intronic
997651798 5:135527333-135527355 AAGAGCCAGGTGTAGTTATGTGG + Intergenic
999772402 5:154785553-154785575 CAGAGGAAGGTGAAGTTCAGAGG + Intronic
1001429345 5:171647176-171647198 CAGACCCTGATGGAGTTCTCAGG + Intergenic
1003038867 6:2669159-2669181 GTGACTCAGGTGAATTTCTGAGG + Intronic
1003149688 6:3538159-3538181 CAGCCCCAGGGGCAGCTCTGAGG + Intergenic
1003721315 6:8705733-8705755 CTAACCCAGTTGTAGTTCTGAGG + Intergenic
1007782868 6:44264287-44264309 CAGACCCAGATGGAGTTTGGTGG - Intronic
1012997219 6:105985872-105985894 TGGACCTAGGTGAAGTGCTGGGG - Intergenic
1014747889 6:125221252-125221274 CAGACCCAGCTAAAGATTTGAGG - Intronic
1017051108 6:150394525-150394547 CAGACCCACATGAAGTACTTTGG + Intronic
1018884409 6:167921052-167921074 CAGGCCCATGTGAGGTGCTGAGG - Intronic
1019429517 7:992248-992270 CAGACCCAGAAGCAGATCTGGGG - Intergenic
1021402305 7:20223174-20223196 CAGAGGCAGGTGATGTTTTGGGG - Intergenic
1025069138 7:55883741-55883763 CACACCGAGGTGCAGCTCTGTGG - Intergenic
1026149752 7:67777856-67777878 CAGACCCAGGAGATGCTCAGTGG - Intergenic
1028297539 7:89153656-89153678 CAGACCTAGGACCAGTTCTGTGG + Intronic
1028404586 7:90461642-90461664 CATACCAAGGTGATGCTCTGAGG + Intronic
1031293850 7:119976778-119976800 CAGACACAGGTGTATTTGTGGGG + Intergenic
1031966265 7:128030492-128030514 CAGACGGAGGGGCAGTTCTGGGG + Exonic
1032222724 7:130006786-130006808 TGGACACAGGTGAAGATCTGGGG + Intergenic
1034410422 7:150938495-150938517 CAGAGCCTGGTGCAGGTCTGAGG - Intergenic
1035395995 7:158534962-158534984 CATACTGAGGTGTAGTTCTGGGG - Intronic
1036280028 8:7392882-7392904 CAGAACGAGGGGATGTTCTGGGG - Intergenic
1036341497 8:7919001-7919023 CAGAACGAGGGGATGTTCTGGGG + Intergenic
1036728977 8:11245087-11245109 CAGGCCCAGGTGAAGTACATGGG + Intergenic
1040985512 8:53290150-53290172 CACACCCAGGTGATGTTCCAAGG + Intergenic
1041300171 8:56403416-56403438 CAGACCCAGATGCATTTCAGTGG + Intergenic
1045408114 8:101888033-101888055 CAGTCCCAGTGAAAGTTCTGAGG + Intronic
1045609236 8:103816285-103816307 GAGAACCAGATGAAGTCCTGTGG + Intronic
1047783957 8:128135619-128135641 CAGACACAGTGGAAGTTCTGGGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055334502 9:75219549-75219571 CAGACCCAGATTGAGTTCTGAGG + Intergenic
1055429319 9:76227733-76227755 CAGACCAAGGAGAATATCTGTGG - Intronic
1056899633 9:90585458-90585480 CAGCACCAGCTGATGTTCTGCGG - Intergenic
1056919989 9:90778873-90778895 CAGCCCCAAGTGGACTTCTGGGG - Intergenic
1057283197 9:93727284-93727306 CAGACCCATGTGATACTCTGAGG + Intergenic
1058850515 9:109007491-109007513 CACACCAGGGTGGAGTTCTGTGG + Intronic
1061904741 9:133690843-133690865 CTGGCCCAGATGCAGTTCTGCGG + Intronic
1061993543 9:134173004-134173026 CAGACCCCCGTGCAGTTCTCTGG + Intergenic
1188127333 X:26385157-26385179 CAGGCCAAAGTGAAGTTTTGTGG + Intergenic
1188818079 X:34739721-34739743 CAGGCCTAAGTGAGGTTCTGGGG - Intergenic
1188999906 X:36933028-36933050 CGGGCCCAAGTGAGGTTCTGGGG + Intergenic
1189123921 X:38425454-38425476 CCCACCCACGTGGAGTTCTGGGG - Intronic
1193732941 X:85123301-85123323 CAGACACTGGTGAGGTTGTGGGG - Intergenic
1199338634 X:146649266-146649288 CAGATGCTGGTGAAGTTGTGTGG + Intergenic
1199574544 X:149300821-149300843 CAGACCCAGGTGAGATTCTGTGG + Intergenic
1199852121 X:151732210-151732232 TAGATCTTGGTGAAGTTCTGAGG - Intergenic
1200239262 X:154485382-154485404 CAAACCCAGGTCAAGCTGTGAGG + Exonic