ID: 1178668481

View in Genome Browser
Species Human (GRCh38)
Location 21:34569545-34569567
Sequence CAGGGTAGGCAGGTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 939
Summary {0: 1, 1: 0, 2: 7, 3: 93, 4: 838}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178668481_1178668490 -1 Left 1178668481 21:34569545-34569567 CCTTCCTCCACCTGCCTACCCTG 0: 1
1: 0
2: 7
3: 93
4: 838
Right 1178668490 21:34569567-34569589 GGAGTCACTGCCAGAGGCTAAGG 0: 1
1: 0
2: 2
3: 20
4: 264
1178668481_1178668491 2 Left 1178668481 21:34569545-34569567 CCTTCCTCCACCTGCCTACCCTG 0: 1
1: 0
2: 7
3: 93
4: 838
Right 1178668491 21:34569570-34569592 GTCACTGCCAGAGGCTAAGGTGG 0: 1
1: 0
2: 3
3: 22
4: 328
1178668481_1178668487 -7 Left 1178668481 21:34569545-34569567 CCTTCCTCCACCTGCCTACCCTG 0: 1
1: 0
2: 7
3: 93
4: 838
Right 1178668487 21:34569561-34569583 TACCCTGGAGTCACTGCCAGAGG 0: 1
1: 0
2: 1
3: 15
4: 169
1178668481_1178668493 16 Left 1178668481 21:34569545-34569567 CCTTCCTCCACCTGCCTACCCTG 0: 1
1: 0
2: 7
3: 93
4: 838
Right 1178668493 21:34569584-34569606 CTAAGGTGGAGAAATCACTGTGG 0: 1
1: 0
2: 1
3: 24
4: 270
1178668481_1178668494 29 Left 1178668481 21:34569545-34569567 CCTTCCTCCACCTGCCTACCCTG 0: 1
1: 0
2: 7
3: 93
4: 838
Right 1178668494 21:34569597-34569619 ATCACTGTGGCAGAGCTTTCAGG 0: 1
1: 0
2: 2
3: 15
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178668481 Original CRISPR CAGGGTAGGCAGGTGGAGGA AGG (reversed) Intronic
900119882 1:1044020-1044042 CAGGGTAGGCCGGGGGACGCTGG + Exonic
900158920 1:1214218-1214240 CAGAGGAGGCGGGAGGAGGAAGG + Intergenic
900210335 1:1452453-1452475 CAGGGCTGGCAGGTGGCTGAGGG + Intronic
900223258 1:1520636-1520658 CAGGGCTGGCAGGTGGCTGAGGG + Intronic
900378684 1:2373134-2373156 CAGGGATGGCAGGTGGGGGCAGG - Intronic
900402104 1:2476816-2476838 CAGGGGAGGCGAGTGCAGGATGG - Intronic
900466705 1:2829168-2829190 CGCGGCAGGCAGATGGAGGATGG - Intergenic
900540986 1:3202571-3202593 AAGGGTCTGCAGGTGAAGGATGG + Intronic
900700782 1:4047487-4047509 AAGGGGAGGAAGGAGGAGGAAGG + Intergenic
900753745 1:4418633-4418655 GAGGGAAGGAAGGAGGAGGAGGG - Intergenic
900852932 1:5157999-5158021 CAGGGGAGGAAAGTGGATGAAGG - Intergenic
900878500 1:5363662-5363684 CAGGGTGGGCAGGTGGAAAGAGG - Intergenic
901055152 1:6445818-6445840 CTGGGTAGCCAGGTGGGGGTGGG - Exonic
901214932 1:7550004-7550026 GAGGGAAGGAAGGAGGAGGAGGG + Intronic
901667445 1:10834866-10834888 CAGAGGAGGCTGGTGGCGGATGG + Intergenic
901738115 1:11325160-11325182 CAGGGTGGGCGGGAGGCGGACGG - Intergenic
901875812 1:12166723-12166745 CTGGGAGGGCAGGTGGAGGCCGG + Intergenic
902037492 1:13468236-13468258 CAGGGTGGACAGTTTGAGGAAGG + Intergenic
902290509 1:15431836-15431858 CAGAGAAAGCAGGTTGAGGAGGG + Intergenic
902727134 1:18344680-18344702 CAGGGTAGGTCAGTGGAGGGAGG + Intronic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
902876638 1:19344492-19344514 CAGGGCTGGCAGGTGGAGGGAGG - Intronic
903228762 1:21909319-21909341 CAGGGCAGGCAGATGGAGCCTGG + Intronic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
903302740 1:22390773-22390795 TAGGGGAGGGAGGTGGAGGCTGG - Intergenic
903474063 1:23607381-23607403 CAGGGCTGGGAGGTGGGGGAAGG - Intronic
903476236 1:23620800-23620822 CTGCGGAGGCAGGAGGAGGAAGG - Intronic
903515621 1:23909008-23909030 CAGTGGAAGCAGGTGGGGGAGGG + Intronic
903744875 1:25580165-25580187 CAGGGTAGGCTCCTGGTGGATGG + Intergenic
904047656 1:27618183-27618205 GAGGGCAGGCAGGAGGGGGACGG + Intronic
904386873 1:30148664-30148686 GAGGGTGGGCAGATGGAGCAGGG + Intergenic
904396003 1:30222743-30222765 CAGGGTAAGATGGTGGAGTAGGG - Intergenic
904446940 1:30581426-30581448 CAGGGTCGGGGGCTGGAGGAGGG - Intergenic
904493921 1:30876482-30876504 CAGGGGAGGGATGAGGAGGATGG - Intronic
904557127 1:31372728-31372750 CACGGTAGGGAGGTGGTGGAAGG - Intronic
904703395 1:32372603-32372625 CAGGGTAGGACGGTGGAAGGAGG - Intronic
904832549 1:33314423-33314445 CAGGAGAGGCAGGGGCAGGAGGG - Intronic
905282968 1:36860685-36860707 CAGGGTGGGCTGGTGAAGGAAGG + Intronic
905811562 1:40917030-40917052 CTGGGCAGGAGGGTGGAGGATGG + Intergenic
905844102 1:41212016-41212038 CGGGGTAGGGAGCTGGGGGAGGG + Intronic
906220053 1:44071476-44071498 CAGGGAAGGCTGGAGAAGGAAGG - Intergenic
906518377 1:46452864-46452886 CAGGGATGGCAGGTGGAAGGCGG - Intergenic
906621032 1:47279421-47279443 TGGGGTAGGTATGTGGAGGAAGG + Intronic
906636509 1:47413923-47413945 CAGGGTGGGGAGGTTGAAGAGGG + Intergenic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
907045035 1:51295419-51295441 CAGCCTTGGCAGGTGGAGGATGG - Intronic
907046254 1:51302088-51302110 CAGTGGAGGGAGGTGGAGGGAGG - Intronic
907313603 1:53553851-53553873 CAGAACGGGCAGGTGGAGGATGG + Intronic
907364545 1:53947132-53947154 AAGGGGAGGCAGGTGAAGGTTGG + Intronic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
909480583 1:76125468-76125490 GAGGGGAGAGAGGTGGAGGAGGG - Intronic
910736118 1:90459632-90459654 GAAGATAGGCAGGTGGATGATGG - Intergenic
911037869 1:93569419-93569441 CATGGTGGGCAGCAGGAGGAAGG - Intronic
911218081 1:95217084-95217106 CAGGGGAGGCACCTGGTGGAAGG - Intronic
912429079 1:109619795-109619817 CGGGGTCGGCAGGCGGAGGCGGG + Intronic
913056661 1:115168307-115168329 CGGGGTAGGGAAGTTGAGGAAGG - Intergenic
913117889 1:115713489-115713511 CAGGGTAGGAAGCTGAGGGAAGG - Intronic
914675557 1:149904940-149904962 CAGGGCAGGGAGGGGAAGGAAGG + Exonic
914901801 1:151715097-151715119 CACCATAGGCAGGTGGAGGACGG + Intronic
915273417 1:154771909-154771931 CAGGGAAGGGAGGAGGAGTAGGG - Intronic
915280417 1:154818604-154818626 CAGGGAAGGCAGGAGGCTGAGGG - Intronic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915657640 1:157375020-157375042 TAGGGTGGGCAGATGCAGGAGGG - Intergenic
915818302 1:158993675-158993697 GAGGGTAGAGAGTTGGAGGAGGG - Intergenic
915952489 1:160198759-160198781 GAGGGAAGGCAGGGGGAGGTGGG + Intronic
916058373 1:161083249-161083271 GGGGGTATGCAGCTGGAGGAGGG - Intronic
916720768 1:167483409-167483431 CAGGGTAGGGAGGGGGAGGGAGG - Intronic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917302158 1:173587209-173587231 AAGGTTTGGCAGGTGGTGGAGGG - Intronic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
917535700 1:175872908-175872930 CAGGGTCGGCAACTGCAGGACGG + Intergenic
917755065 1:178090757-178090779 CAGGATAGGGAGGTGAAGCAGGG + Intergenic
917794766 1:178525305-178525327 CAGAGTAGGCATGGGGAGGCAGG - Intronic
918109134 1:181440545-181440567 CAGGGTAGGCAGAGGCAGAAAGG + Intronic
918148943 1:181781610-181781632 CAGGCTGGGGAGGTGGAGGAGGG + Intronic
918246317 1:182662824-182662846 TATGGTAAGCAGCTGGAGGAGGG - Intronic
918249015 1:182685184-182685206 CAGGATGGGCAGGTGGTCGAGGG - Intergenic
918462230 1:184788612-184788634 CAGGGTAGGCAGCTGGATTTTGG + Intergenic
918472270 1:184886274-184886296 CAGGGTAGGGAGGCGGGGGAGGG + Intronic
918634914 1:186764230-186764252 TAGGATAGGGAGGTGGAAGATGG - Intergenic
918778590 1:188668387-188668409 GAAAGTAGACAGGTGGAGGAAGG - Intergenic
919150404 1:193690030-193690052 CAGGGTGGGAAGGGGGTGGATGG + Intergenic
919469470 1:197960479-197960501 CAGGGTAGGGAGGTAGGGAACGG - Intergenic
919724154 1:200871345-200871367 CAGGGTAGGAAGGTGGGGGCAGG - Intergenic
920066927 1:203275839-203275861 CAGGGAAGGCATGTGGCTGAGGG - Intergenic
920100767 1:203515720-203515742 CAGGGGAGAAAGGTGGAGGTGGG + Intergenic
920195632 1:204224488-204224510 CAGGGTAGGGTGGGGGACGAGGG - Intronic
920309660 1:205041616-205041638 CAGTGTGGGCAGGGGAAGGAAGG + Intergenic
920910933 1:210215683-210215705 TAGAGTAGGGAGGAGGAGGAGGG + Intergenic
921322291 1:213953723-213953745 CTGTGTGGGCAGGTGGAGGCTGG - Intergenic
922056094 1:222043818-222043840 CAGGCTGGGCAGGAGGGGGAAGG + Intergenic
922506679 1:226130128-226130150 CAGGGAAGGGTGGTGGAGAAGGG + Intergenic
922720142 1:227896148-227896170 CAGGGGAGGCAGCTGGATGCTGG - Intergenic
922751669 1:228073075-228073097 CAAAGTAGGCAGGTGGTGGGAGG - Intergenic
922772726 1:228196363-228196385 CAGGGTCTGCAGGGGGAGTAGGG - Intergenic
922789493 1:228303362-228303384 CTGGGTAGGCAGAGGTAGGAAGG - Intronic
922790072 1:228306401-228306423 CAGAGTCTGCAGGCGGAGGAGGG + Exonic
922935667 1:229420297-229420319 CAAGGCAGGCAGGTGGAAGCAGG - Intergenic
923224593 1:231927550-231927572 CAAGGTAGGCAGGTGGATGAGGG - Intronic
924493035 1:244558735-244558757 CAGAGTGGGCAGGAGGAGAAGGG - Intronic
1062812525 10:477426-477448 GGGGGGAGGCAGGGGGAGGAAGG + Intronic
1063143603 10:3276572-3276594 CCGGGAGGGCAGTTGGAGGAGGG - Intergenic
1063291665 10:4756090-4756112 CAGGGTGGGGAGCTGGGGGAGGG - Intergenic
1063295487 10:4800897-4800919 CAGGCTGTGCAGGAGGAGGATGG - Intronic
1063371511 10:5525607-5525629 CAGGGGAGGCAGGGGGATGGGGG - Exonic
1063495322 10:6502230-6502252 CAGCTAAGGCAGGTGGAGGTAGG + Intronic
1063662436 10:8043705-8043727 CAGGGCAGGAAGGTGGAGGAGGG + Intergenic
1063898682 10:10709422-10709444 CAGGGTGGGCGTGGGGAGGAAGG - Intergenic
1064680182 10:17803589-17803611 AAGGGGTGGGAGGTGGAGGATGG - Intergenic
1064750402 10:18522531-18522553 CAGGGGAGGCAAGGGTAGGAAGG + Intronic
1064804343 10:19113557-19113579 AAGGCAAGGGAGGTGGAGGAAGG - Intronic
1065320242 10:24502586-24502608 CAGGGCAGGGAGGTGGGAGAAGG - Intronic
1066059520 10:31709410-31709432 CAGGGTAGAGGGGTTGAGGAGGG + Intergenic
1067030358 10:42875476-42875498 CAGGGAAGGCTGGAGGAAGAGGG - Intergenic
1067051746 10:43025433-43025455 CACTGTAGGCAGGTTGGGGAGGG - Intergenic
1067196896 10:44127912-44127934 CAGGGTGGGGAGCTGGGGGATGG - Intergenic
1067575156 10:47404167-47404189 CAGGCTGGGGAGCTGGAGGAAGG + Intergenic
1067990121 10:51202382-51202404 CAGGATAGAATGGTGGAGGATGG - Intronic
1068943457 10:62704491-62704513 GAGGGTGGGGAGCTGGAGGAGGG + Intergenic
1068950846 10:62775603-62775625 CAGGGTAGGCAGGTTGTGGGTGG - Intergenic
1069615337 10:69802975-69802997 CACGCCGGGCAGGTGGAGGAAGG + Intronic
1069729760 10:70602946-70602968 CAGGGCACACAGGCGGAGGAGGG + Intergenic
1069776516 10:70930322-70930344 CAGGGGAGGCAGGAAGATGAAGG - Intergenic
1069777762 10:70936755-70936777 CAGAGGAGGAGGGTGGAGGATGG - Intergenic
1069833797 10:71296367-71296389 GAGGGTGGGTAGGTGGGGGAGGG - Intronic
1069959364 10:72070548-72070570 GAGGGTGGGCAGGGGCAGGAAGG - Intronic
1070042484 10:72795284-72795306 AAGGGATGGCAGGTGGAGGCAGG - Intronic
1070328807 10:75403982-75404004 GAGGGGAGTCAGGTGGGGGAGGG - Intergenic
1070756264 10:78995256-78995278 AAGGGTGGGCAGGTGGTGGGAGG - Intergenic
1072008866 10:91286269-91286291 CAGGGTTTGCAGGAGGAGCAGGG - Intergenic
1072278081 10:93842200-93842222 CAGGGTAAGCAGGCTTAGGATGG - Intergenic
1072285587 10:93911250-93911272 CAGGGATGTCAGGTGGACGATGG + Intronic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072490837 10:95904676-95904698 CAGGGGAGGGAGGTGGGGAAAGG + Intronic
1072765065 10:98088581-98088603 CAGGGGTGGCAGGTGCTGGAGGG + Intergenic
1072808613 10:98443094-98443116 CAGGGTAGGCAGTCCCAGGAGGG - Intronic
1073285109 10:102382785-102382807 GAGGGTAGGCAGGTGGGGGCTGG + Exonic
1073319022 10:102602763-102602785 CCGGGAAGGCAGTGGGAGGAGGG - Intronic
1073327421 10:102650777-102650799 CTGGGGAGGCAGGTGGGGGTTGG + Intronic
1073348467 10:102802002-102802024 AAGGGTGGGAAGGTGGGGGAGGG - Intronic
1073427738 10:103466117-103466139 CAGGGAAGGGAGGTTGAAGAAGG - Intergenic
1073499285 10:103921273-103921295 CAGGGATGGCAGGTGGGGGGCGG + Intergenic
1073901647 10:108229301-108229323 CAGGGCAGGGAGGTGGAACATGG + Intergenic
1074532194 10:114305447-114305469 GAGGGGACGCAGGTGCAGGAGGG + Intronic
1074532246 10:114305657-114305679 GAGGGGATGCAGGTGCAGGAGGG + Intronic
1074757469 10:116635119-116635141 CAGGGTGGGCTGGAGGGGGAAGG + Intronic
1075067248 10:119297439-119297461 CAGAGCAGCCTGGTGGAGGATGG - Intronic
1075444051 10:122501522-122501544 CAGGGAAGGAAGTTGGAGGGTGG - Intronic
1075603241 10:123786396-123786418 CAGGGAAGGCAGCTGGAAGCAGG - Intronic
1075702435 10:124478126-124478148 CAGAGGAGGCAGGAGGAGGGAGG + Intronic
1076009359 10:126974994-126975016 TATGGGAGGCAGGAGGAGGAAGG - Intronic
1076090429 10:127680805-127680827 CAGGGAAGCCAGCTGGAGGAAGG + Intergenic
1076413161 10:130265879-130265901 CAGAGGAGGGAGGTGGAGGGAGG + Intergenic
1076858310 10:133128035-133128057 CTGGGTGGGCAGGGGCAGGAAGG - Intronic
1076917864 10:133433361-133433383 CAGCGGAGGCAGGTAGAGGCGGG - Intergenic
1076937862 10:133577438-133577460 CAGCGGAGGCAGGTAGAGGCGGG - Intergenic
1077015937 11:399277-399299 GATGGTGGGCAGGTGGAGGGGGG - Intronic
1077015950 11:399305-399327 CAGAGGGGGCAGGTGGAGAAGGG - Intronic
1077015992 11:399409-399431 CAGAGGGGGCAGGTGGAGGAGGG - Intronic
1077016021 11:399482-399504 CAGAGGGGGCAGGTGGAGGAGGG - Intronic
1077231606 11:1460287-1460309 CAGGGTGGGCAGGCGGCGGCCGG - Intronic
1077252514 11:1566837-1566859 CCGGGTGGGCAGGTGGAGTAGGG + Intronic
1077301922 11:1851472-1851494 GAGGACAGGCAGGTGGAGGCTGG - Intergenic
1077388592 11:2288222-2288244 CAGTGGAGGCAGGTGCAGAAAGG + Intergenic
1077426990 11:2485359-2485381 CAGGGTGGGGGGGTGGGGGATGG - Intronic
1077501475 11:2911484-2911506 CAGGGTGGCCAGGGTGAGGAAGG + Intronic
1077824568 11:5791227-5791249 CTTGGGAGGCAAGTGGAGGAGGG + Intronic
1078257901 11:9675719-9675741 CAGGGAATGCAGGAGAAGGAAGG - Intronic
1078655875 11:13238575-13238597 GAGGGTGGGCAGCGGGAGGATGG + Intergenic
1079107018 11:17578291-17578313 CAGGGGCAGCAGCTGGAGGATGG - Intronic
1079254054 11:18811271-18811293 GAGAGTGGGCAGCTGGAGGATGG + Intergenic
1079332442 11:19544989-19545011 CAGGGTAGAGAGGTGGAGAGTGG - Intronic
1080266868 11:30410188-30410210 GAGGGTTGGATGGTGGAGGATGG - Exonic
1080870054 11:36229175-36229197 AAGAGTAGGGCGGTGGAGGAAGG - Exonic
1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG + Intergenic
1081657673 11:44868174-44868196 CAGGGGACGCAGTTGGAGGCTGG + Intronic
1081736972 11:45410998-45411020 AAGGGCAGGGAGGTGGAGGCGGG - Intergenic
1081824923 11:46040283-46040305 CAGGGTGGGGAGGTGCTGGAAGG + Intronic
1081851029 11:46275452-46275474 AAGGGGTGGCAGGGGGAGGAGGG - Intergenic
1082987425 11:59180623-59180645 CAGGGTGGGGAGGTCGGGGAGGG - Intronic
1083261743 11:61526881-61526903 CTGGGAAGGCAGGTGGGGAAAGG + Intronic
1083273127 11:61581848-61581870 CAGGGTTGGAAGGAGAAGGAGGG - Intergenic
1083276478 11:61599847-61599869 CAGGGTAGGTAGTTGGGGGCTGG - Intergenic
1083936433 11:65872326-65872348 CCGGGTAGGCAGGAGGCGCAGGG + Exonic
1083941007 11:65895798-65895820 CTTGGTCGGCAGGTAGAGGATGG - Intronic
1084008743 11:66336280-66336302 CAGGGCAGCCAGGTGGGGCAGGG - Intronic
1084468509 11:69341484-69341506 CAAGGTAGGAAGGAAGAGGAAGG - Intronic
1084593950 11:70106152-70106174 CAGGGCAGGCAGGTGTGGGCAGG + Intronic
1088223105 11:107590717-107590739 CCGGGAAGGCAGGTGAAGGGTGG + Intergenic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1088585385 11:111356336-111356358 CTGGGTAGGCAGGTGGACCTGGG + Intronic
1088735194 11:112723020-112723042 CAGGAGAGGCTGGTGGAAGATGG + Intergenic
1088737011 11:112736113-112736135 CAAGGCAGGCAGGAGCAGGAGGG + Intergenic
1088878370 11:113954455-113954477 CAGGGTAAGCAGGCTTAGGACGG + Intergenic
1089296763 11:117473895-117473917 CAGGCTAGTCATGTGGAGGCAGG + Intronic
1089597453 11:119589878-119589900 GAGGGAAGGAGGGTGGAGGAGGG + Intergenic
1090205277 11:124880379-124880401 AAGGGTAGCCAGGTGCAGGCAGG - Intronic
1090208527 11:124899027-124899049 CAGGATGGGAAGGGGGAGGAAGG - Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1091113890 11:132996023-132996045 CATGGATGGCAGGGGGAGGATGG - Intronic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091233176 11:134001580-134001602 CAGGGAAGGCAGGCATAGGATGG - Intergenic
1091541352 12:1465656-1465678 CAGGGGAGTCAAGTGGAGAATGG - Intronic
1091670316 12:2447721-2447743 CTGGCTAGGCAGGAGGAGGTGGG + Intronic
1092239474 12:6828352-6828374 AAGGGGAGGGAGGGGGAGGAAGG - Intronic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1092892428 12:12981186-12981208 CAGGGTGGGTAGGAGGAGGGAGG + Intronic
1094524023 12:31219898-31219920 CAGGGCAGGCTCCTGGAGGAGGG - Intergenic
1096186866 12:49587259-49587281 CAGGGGAGCCAGGTGTAGGGAGG - Intronic
1096218117 12:49809485-49809507 GAGGGTGGGCAGCTGTAGGAAGG + Intronic
1096280857 12:50252200-50252222 AAGTGAAGGCAGGAGGAGGAAGG + Intronic
1096407416 12:51354101-51354123 TAGGGAAGGCAGCTGGGGGAGGG - Exonic
1096652184 12:53067269-53067291 GAGGGCAGGCAGGGGGAGGTGGG + Intronic
1097245364 12:57604946-57604968 CGGGGAGGGGAGGTGGAGGAGGG - Intronic
1097324687 12:58262947-58262969 CAGGCTAGCCAGCTGGAGGTTGG + Intergenic
1097351401 12:58553209-58553231 AAGGGTAGGAAGGAGGAGCAGGG - Intronic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1099536733 12:83855023-83855045 CAAGATAGGCAGATGTAGGAAGG + Intergenic
1100224907 12:92546644-92546666 GAGTGTAGATAGGTGGAGGAAGG - Intergenic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1100790910 12:98128901-98128923 GTGGGAAGGCAGGTGCAGGATGG - Intergenic
1101473554 12:105021890-105021912 TAGGGTAGGAAGGTCCAGGAAGG + Exonic
1101836833 12:108301834-108301856 CAGGGCAGAGAGGTGGAGGCTGG - Intronic
1101841311 12:108329269-108329291 CAGGGATGGCAGGAGGAGGTCGG - Intronic
1102887688 12:116534134-116534156 GGGGGGAGGCAGGTGGGGGAGGG - Intergenic
1103871235 12:124093761-124093783 CAGGGAAGGCAGCAGGAAGAGGG + Intronic
1103935067 12:124471265-124471287 CACTGTAGGCAGGTGGGTGAAGG - Intronic
1103972120 12:124678892-124678914 CAGGGGAGGGAGGAAGAGGAGGG - Intergenic
1104248290 12:127063880-127063902 CAGGGCAGGCAGGAGCAGGCTGG - Intergenic
1104690081 12:130819048-130819070 CAGGGCAGAGAGGTGGACGAAGG - Intronic
1104718983 12:131034174-131034196 CAGGGTGGGCAGGGGAAGAAGGG - Intronic
1104759684 12:131289438-131289460 CAGGGGAGGCGGGTGGGGAAGGG + Intergenic
1104768748 12:131346788-131346810 CAGGGCAGGCATTTAGAGGAAGG - Intergenic
1104821029 12:131677775-131677797 CAGGGGAGGCGGGTGGGGAAGGG - Intergenic
1104984213 12:132587490-132587512 GAGGGTGGGCAGCTGGAGGGTGG + Intergenic
1105410260 13:20165914-20165936 CAGAGAAGGCAGGAGGAGCAGGG + Intergenic
1105459623 13:20571421-20571443 GAGGGGTGGGAGGTGGAGGAAGG - Intronic
1106994000 13:35459322-35459344 CAGGGCTGGTAGGTGGAAGAGGG + Intronic
1107086205 13:36430693-36430715 CACTGTTGGCAGGTGGGGGAGGG + Intergenic
1107272489 13:38636288-38636310 CAGGGCAGCCACGTGGTGGAAGG - Intergenic
1107430696 13:40337837-40337859 CTGGGGATGCACGTGGAGGAAGG + Intergenic
1108348320 13:49567481-49567503 CGGGGTTTGAAGGTGGAGGAGGG - Intronic
1108504384 13:51097995-51098017 TAGGGTAGGGAGATGGAGCAGGG - Intergenic
1108575050 13:51783259-51783281 CAGGGGAGGCTGGTGGAGTCTGG - Intronic
1109143194 13:58743048-58743070 AAGGCTAGGCAGGTGTAGGAAGG - Intergenic
1110148386 13:72221489-72221511 CAGGGTAGGTAGGTGCCTGAGGG + Intergenic
1110387982 13:74936847-74936869 CAGGGTGGGGAGCTGGGGGAGGG + Intergenic
1110390995 13:74973839-74973861 CAGGGAAGGGAGGAAGAGGAAGG + Intergenic
1110818218 13:79884334-79884356 CAGGGTATTGAGCTGGAGGATGG + Intergenic
1110844586 13:80179821-80179843 CAGGGGAGAATGGTGGAGGAAGG - Intergenic
1111125279 13:83906661-83906683 GAGGGTAGGGACGTGGGGGACGG + Intergenic
1111180855 13:84662966-84662988 CAGGGTAGGCAGGTTTGGAAGGG - Intergenic
1112461289 13:99605990-99606012 GAAGGTCGGCAGGTGGAGGCCGG + Intergenic
1112840546 13:103572255-103572277 AAGGGAAGAGAGGTGGAGGAAGG - Intergenic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1113447411 13:110379910-110379932 GAGAGGAGGCAGGTGGAGGAGGG - Intronic
1113486611 13:110657422-110657444 AAAGGCAGGCAGGTGCAGGAGGG + Intronic
1113946967 13:114049890-114049912 CAGGGGAGGCAGGTCACGGAGGG + Intronic
1114557707 14:23571319-23571341 CAGGGTTGGCGGGAGGAGGCAGG + Exonic
1114625982 14:24130731-24130753 CAGGGTAGTTGGTTGGAGGATGG + Intronic
1114756884 14:25269609-25269631 CAGAGTGGGCAGGTGGGGAAGGG - Intergenic
1115524985 14:34270931-34270953 CAGGGTAGCCAGGTGGCTCAGGG + Intronic
1116781283 14:49240603-49240625 CAGGGTAGGTTGGTGGGGGCAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1119145576 14:72310745-72310767 CAGGGGAGGCTGGTGGTGGAAGG - Intronic
1119211645 14:72836439-72836461 CAGGGCAGGCAGGAGCAGGGAGG - Intronic
1119670382 14:76513913-76513935 CAGGGCAGCTGGGTGGAGGATGG - Intergenic
1119699447 14:76743233-76743255 AGGGCTTGGCAGGTGGAGGAGGG - Intergenic
1119758941 14:77138127-77138149 CAGGGTAGGGAGGAAGTGGAAGG + Intronic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1120856749 14:89219149-89219171 CAGGGGAGGGAGGTGGTGGGAGG + Intronic
1120974281 14:90235232-90235254 CCGGGTAGCCAGGTGGAGCCTGG + Intergenic
1122359642 14:101151704-101151726 CAAGGCAGGGAGGTGGAGGGAGG - Intergenic
1122363406 14:101180758-101180780 CAGGGAAGGGAGGTGCAGGCAGG - Intergenic
1122718828 14:103710924-103710946 CAGGGTAGGCAAAGGAAGGAAGG + Intronic
1122849027 14:104516705-104516727 CAGGGTAGGCAGGAGGCTGAGGG + Intronic
1122889260 14:104724917-104724939 CAAGGTCTGCAGGTGGTGGAGGG + Intronic
1122982750 14:105198988-105199010 CAGGCCAGTGAGGTGGAGGAGGG - Intergenic
1123005889 14:105323669-105323691 CAGGGTGTGCAGGTGGAGATGGG + Intronic
1123022927 14:105410692-105410714 CTGGTGAGGGAGGTGGAGGATGG + Intronic
1123043541 14:105500243-105500265 CAGAGGCTGCAGGTGGAGGAGGG - Intergenic
1123058836 14:105585356-105585378 GTGGGTAGGCGGATGGAGGATGG - Intergenic
1123083163 14:105705582-105705604 ATGGGTAGGCGGATGGAGGATGG - Intergenic
1202905142 14_GL000194v1_random:67288-67310 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1125798801 15:42425948-42425970 CAGGGTTGGCTGGGGGATGAAGG - Intronic
1125892418 15:43276429-43276451 CAGGGAGGGCAGCTGGAGGGCGG + Exonic
1127117715 15:55743580-55743602 GAGGGTAGGAGGGTGTAGGAGGG - Intergenic
1127395278 15:58539674-58539696 GAGGGGAGGCAGGTGATGGAAGG - Intronic
1127395632 15:58541985-58542007 GAGGGAAGGGAGGTGAAGGAAGG - Intronic
1127404385 15:58625974-58625996 CAGGGTAGCAGGGGGGAGGAAGG + Intronic
1128090348 15:64914971-64914993 CAGCGTGGGCAGGTGGAAGCTGG + Intronic
1128115514 15:65102479-65102501 CAGGAGAGGCCGGAGGAGGAGGG - Exonic
1128338411 15:66803143-66803165 ATGGGGAGGCAGGGGGAGGAGGG - Intergenic
1128585431 15:68845367-68845389 CACGGGATGCAGGTGGAGGGAGG - Intronic
1128701938 15:69811103-69811125 CAGAGGAGGCAGGGGAAGGAAGG - Intergenic
1128706097 15:69838398-69838420 CAGGGAAGGGAGCTGGGGGAGGG - Intergenic
1128733597 15:70036954-70036976 GAGGGTCAGCAGGTGGAGGGAGG - Intergenic
1129599606 15:76990925-76990947 CAGGGGAGGCAGTTGGAAGCAGG - Intergenic
1129674235 15:77623666-77623688 AAGGGGAGGCAGGTGGGGGCGGG - Intronic
1129697363 15:77748253-77748275 CAAGGTGGGGAGGAGGAGGACGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130894044 15:88157073-88157095 CAGGACAGGTGGGTGGAGGAGGG - Intronic
1131023756 15:89122199-89122221 CATGGTAGGAAGATGGAAGAAGG - Intronic
1131501551 15:92972471-92972493 CAGTGTAGGAAGGTTGGGGAGGG - Intronic
1131583119 15:93664648-93664670 CAGGGTTAGCAGTTAGAGGAGGG - Intergenic
1132666050 16:1081828-1081850 CTGGGGAGGCAGGTCGAGGGGGG - Intergenic
1132690595 16:1180363-1180385 CAGGGCAGGCTGGGTGAGGAGGG + Intronic
1133032471 16:3017888-3017910 GAGGCAAGGCAGGTGGGGGAGGG + Intronic
1133603315 16:7361129-7361151 GAGGGCTGGCAGGTGGAGGAAGG - Intronic
1133835698 16:9365542-9365564 CAGGAGAGGCTGGTGCAGGAAGG + Intergenic
1133865438 16:9637629-9637651 CTGGGGAGGCAGGTGGCAGAAGG - Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG + Intronic
1134572482 16:15303208-15303230 CAGGGTAGGCAGATGGGAGAGGG - Intergenic
1134729902 16:16452832-16452854 CAGGGTAGGCAGATGGGAGAGGG + Intergenic
1134911709 16:18033051-18033073 CAGGGGAGGAAGATGGAGGGAGG - Intergenic
1134937530 16:18259064-18259086 CAGGGTAGGCAGATGGGAGAGGG - Intergenic
1135113359 16:19707663-19707685 CTGTGTAGGGAGGTGGGGGAGGG - Intronic
1135553400 16:23415765-23415787 CAGGAAAGGCAGGTGCAGGTTGG - Intronic
1135572017 16:23557091-23557113 CAGAGTGGGCGGGCGGAGGAGGG - Intronic
1135920023 16:26641541-26641563 CAGGGGAGGGAGATGGAGGATGG - Intergenic
1136082308 16:27860207-27860229 CAGGGCAGGCAGGTGCAGACTGG - Intronic
1136170515 16:28486559-28486581 CCAGGTAAGCAGGTGGAGCAGGG - Exonic
1137442027 16:48505962-48505984 CAGGGAAGGTAGGAGGAGGAGGG + Intergenic
1137572820 16:49577971-49577993 CACTGTGGGCAGGTGGAAGAAGG + Intronic
1137815317 16:51392730-51392752 CAGGGTTGGCAAGTGGAGGGAGG - Intergenic
1138112560 16:54336571-54336593 GAGGGCAGGAAGGTGGGGGAGGG + Intergenic
1138223029 16:55269239-55269261 GTGGATAGGTAGGTGGAGGATGG - Intergenic
1138287394 16:55820797-55820819 TAGGGGAGGCAGGCAGAGGAAGG - Intronic
1138414294 16:56862551-56862573 CAGGGAAGGCTTCTGGAGGAGGG - Intergenic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1138849039 16:60604785-60604807 CATGGCAGGCAGGAGGAAGAGGG + Intergenic
1139020710 16:62745401-62745423 CAGAGTAGCCAGGTGAAGGGGGG + Intergenic
1139492327 16:67292940-67292962 CAGGCTAGGCAGGTAGTGGAGGG - Intronic
1139758973 16:69168957-69168979 CAGGGTAGACAGTTCAAGGAAGG - Exonic
1139804696 16:69554735-69554757 CATGCTAGGCAGGAGGAGGAAGG - Intergenic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139958387 16:70704170-70704192 CAGGGTGGGCAGGAGGAGTAAGG + Intronic
1140237431 16:73172076-73172098 CCCGGCAGGCGGGTGGAGGAGGG - Intergenic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1140939665 16:79709484-79709506 CAGGGTGGGCAACTGGGGGAAGG - Intergenic
1141048837 16:80742584-80742606 GTGGGTAGATAGGTGGAGGATGG + Intronic
1141089456 16:81120289-81120311 CTGTGGAGGCAGTTGGAGGAGGG + Intergenic
1141148362 16:81547582-81547604 GAGGGTTTGCAGGTGGAGGGTGG + Intronic
1141461707 16:84181767-84181789 CAGGCAATGCAGGTGGAGAAAGG - Exonic
1141612223 16:85188088-85188110 AAGGGGAGGCAGGTGTGGGATGG + Intergenic
1141663317 16:85453286-85453308 GAGGGAAGGGAGGTAGAGGAGGG - Intergenic
1141672893 16:85502124-85502146 GAGGGAAGGCAGCTGGAGGTTGG + Intergenic
1141704645 16:85658181-85658203 CAGGGCAGGCAGGGGCAGGGAGG - Intronic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1141952131 16:87345986-87346008 GAGGGGTGGGAGGTGGAGGAGGG + Intronic
1141964768 16:87434444-87434466 CAGCGAAGGCTGGTGGAGGAAGG - Intronic
1142046309 16:87927275-87927297 GAGGGCAGGTGGGTGGAGGAGGG + Intronic
1142284865 16:89167593-89167615 CAGTGGAGGCGGGTGGGGGAAGG - Intergenic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142599589 17:1047144-1047166 TAGGAAAGGCAGGAGGAGGAGGG - Intronic
1142748716 17:1974646-1974668 CAGGGAAGCCAGGTGGAGACGGG + Intronic
1142887890 17:2924563-2924585 GAGGGAAGGAAGGTGGAAGATGG + Intronic
1143326022 17:6098955-6098977 CAGTGTTGGCAGGTGGCTGAGGG + Intronic
1143520494 17:7441602-7441624 CAGGGTGGGAAGGGGGAGAATGG + Intronic
1143621641 17:8084325-8084347 GAGCTGAGGCAGGTGGAGGAGGG - Intronic
1143740818 17:8952828-8952850 CAGGAAAGGTAGGGGGAGGAGGG + Intronic
1144026296 17:11278889-11278911 CAGGGCAGGAAGGTGGAGCTGGG + Intronic
1144797614 17:17903016-17903038 CAGATGAGGCAGGTGGATGAAGG - Intronic
1144922050 17:18772261-18772283 TAGTGTAGGCAGCTGGAGGGTGG - Intronic
1144991164 17:19234855-19234877 CAGGCTTGGGAAGTGGAGGAGGG - Intronic
1145831654 17:27921228-27921250 CATGGGAGGCAGGTGGTGCATGG - Intergenic
1145990382 17:29075761-29075783 CAGTGGAGGCAGGAGGAGTACGG - Exonic
1146404216 17:32523242-32523264 ATGGGAAGGCAGGTGGGGGAGGG + Intronic
1146458239 17:33023824-33023846 CATGGTAGGCAGGGGGAAGGGGG - Intronic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1146687651 17:34852383-34852405 CAGCTTGGGAAGGTGGAGGAGGG - Intergenic
1146688577 17:34857563-34857585 CAGGGCAGGCAGGTGGCCCAGGG + Intergenic
1147164549 17:38586395-38586417 CAGGGCTGGGAGGTGGAGGAGGG - Intronic
1147363196 17:39944199-39944221 CAGGACAGGCAGGTGCTGGAAGG - Exonic
1147575193 17:41594892-41594914 GTGGGTAGGCAGGTGGGTGAAGG + Intergenic
1147965720 17:44193343-44193365 CAGGGTGGGCAGGAGGAACACGG + Exonic
1148520139 17:48265837-48265859 CAGGGGAGGCATTTGGAGCATGG - Intronic
1148544194 17:48504408-48504430 TAGGGGAGGCAGGTGGAGTGGGG - Intergenic
1148619335 17:49022601-49022623 CAGGAGAGGGAGGGGGAGGAGGG - Intronic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1148887822 17:50786463-50786485 CAGGGTAGGAGGAGGGAGGATGG + Intergenic
1149688047 17:58549781-58549803 CAGGGTAAGCTGTTGGTGGAAGG + Intergenic
1149837453 17:59926017-59926039 CAATGTAGGCAAGTGCAGGATGG - Intronic
1150638310 17:66932084-66932106 CAGGGTGAGCTGGTGAAGGAAGG - Intergenic
1150664471 17:67119459-67119481 CAGGGCTGGGAGCTGGAGGATGG + Intronic
1150979735 17:70127580-70127602 AAGAGTAGGCCGGTAGAGGAAGG - Intronic
1151163846 17:72187782-72187804 CAGGGTGAGCAGGCGGGGGAAGG - Intergenic
1151218995 17:72597854-72597876 CAGGGTAGGGAGGGGGCAGAAGG - Intergenic
1151315852 17:73322111-73322133 CAGGACACGCATGTGGAGGAGGG - Intergenic
1151386852 17:73760258-73760280 CTGGGGAGGCAGGTGGATGCTGG + Intergenic
1151978820 17:77497473-77497495 CAGGGCAGGCAGGTGGCAGGGGG - Intronic
1152037275 17:77881123-77881145 CAGGATAGGAGGATGGAGGATGG + Intergenic
1152261535 17:79269898-79269920 CAGTGTGGGCAGGTGGATAAGGG - Intronic
1152289241 17:79429460-79429482 CAGGCTGGGCAGGAGGAGGGAGG + Intronic
1152301053 17:79495504-79495526 GAGGGTGGGGAGGTGGGGGAGGG + Intronic
1152340810 17:79723385-79723407 CAGGGTATGAAGGGGGTGGAGGG + Intergenic
1152428243 17:80230572-80230594 CAGGCCAGGCTGGTGGAGGAAGG + Intronic
1152933491 17:83122515-83122537 CAGGGGAACCAGGTGGAGGGCGG + Intergenic
1153101389 18:1474160-1474182 CAGGGCAGGCAGGTAGGGGAAGG - Intergenic
1153700821 18:7691967-7691989 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700830 18:7692001-7692023 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700839 18:7692035-7692057 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700848 18:7692069-7692091 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700857 18:7692103-7692125 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700866 18:7692137-7692159 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700875 18:7692171-7692193 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700884 18:7692205-7692227 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700893 18:7692239-7692261 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700902 18:7692273-7692295 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700911 18:7692307-7692329 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700920 18:7692341-7692363 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700929 18:7692375-7692397 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153732559 18:8029311-8029333 CAGGCAGGACAGGTGGAGGAGGG - Intronic
1154163413 18:11996542-11996564 CGGGGTGGGCAGGTGGTGGTGGG - Intronic
1154253724 18:12765616-12765638 CAGAGCAGGCAGGAGGAGGGCGG + Intergenic
1155032786 18:21998767-21998789 TAGGGATGGCAGGGGGAGGAGGG + Intergenic
1155345548 18:24853324-24853346 CAGTGATGGCAGGTGGGGGAGGG + Intergenic
1156459688 18:37314771-37314793 CAAGGTAGGCAGGTGAAGGCAGG - Intronic
1156520843 18:37721298-37721320 CACTGAAGGCAGGTGGAGGGAGG - Intergenic
1156579512 18:38358876-38358898 CAGGGCAGGGATGTGGAAGATGG + Intergenic
1157269851 18:46264686-46264708 CAGGCTGGGCAGGTGGAGGCAGG - Exonic
1157433169 18:47646921-47646943 CAGGAAAGGCAGGAGGAAGAAGG - Intergenic
1158114789 18:53983226-53983248 CTGGGAAGGCTGGTGGGGGATGG + Intergenic
1159442240 18:68496307-68496329 CAGGGTGGGAAGGTGTGGGAGGG + Intergenic
1160026884 18:75225629-75225651 CAGGCTCGGAATGTGGAGGATGG - Intronic
1160444163 18:78914279-78914301 CAGGGAAGCCAGGTGGAAAATGG - Intergenic
1160623526 18:80187609-80187631 CAGGGGAGCCAGGAGGTGGATGG - Intronic
1160632231 18:80254593-80254615 CAGGGCAGGGGGGTGGAGGGTGG + Intergenic
1160696025 19:484912-484934 GAGGGTAGGAAGGTGGGGGTAGG + Intergenic
1160844359 19:1159930-1159952 CAGGGAAGGGAGGTGGGTGAGGG + Intronic
1160965327 19:1744781-1744803 CAGGGTGGACCGGTGGGGGAGGG - Intergenic
1161151995 19:2714482-2714504 AAGGGTGGGGAGGTGCAGGATGG - Intergenic
1161320219 19:3637628-3637650 CCGGGTGGGCCGGAGGAGGAAGG + Intronic
1161347907 19:3777290-3777312 TGGGGGAGGCAGGAGGAGGAGGG + Intergenic
1161520983 19:4723471-4723493 GAGGGAAAGAAGGTGGAGGAGGG + Intronic
1161556534 19:4945777-4945799 CGGGGTAGGGAGGAGGAGGGCGG + Intronic
1161604202 19:5205650-5205672 CAGGGTAGGCGGGTAGAGGGGGG + Exonic
1161643367 19:5437303-5437325 GAGGGTAGGCAGAGGCAGGAGGG + Intergenic
1161652968 19:5496551-5496573 CAGTGTAGTCAGGTGGAGCATGG - Intergenic
1161659664 19:5538154-5538176 CAGGACAGGGAGGTGGAGGCAGG + Intergenic
1161790667 19:6357984-6358006 CAGGGCAGGCAGGGGGTGCAGGG + Intergenic
1161945755 19:7435501-7435523 CAGGGTGAGCAGGTTCAGGATGG + Intronic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162099556 19:8331628-8331650 CAGGGCAAGCAGCTGGAGGTGGG + Intronic
1162303714 19:9858682-9858704 CACCGTAGCCAGGTGGAGGTGGG - Intronic
1162500788 19:11052473-11052495 CAGTATGGCCAGGTGGAGGAAGG - Intronic
1162526304 19:11208878-11208900 AGGGGTTGGCAGGTGGCGGACGG - Intronic
1162926449 19:13932736-13932758 CAGGGCAGGCAGGGGGATGGAGG + Exonic
1163054188 19:14706080-14706102 CAGGAGAGGCAGCTGGAGGTGGG - Intronic
1163166198 19:15499786-15499808 TTGGGCAGGCAGGTGGAGGGAGG - Intergenic
1163646923 19:18494859-18494881 CCGGCTAGGGAAGTGGAGGAAGG - Intronic
1163685618 19:18710222-18710244 CTGGGTGGGTAGATGGAGGAAGG - Intronic
1165122589 19:33570223-33570245 CGGGGCTGGCAGGTGGGGGATGG - Intergenic
1165419612 19:35716442-35716464 AAGGGGAGGCCGGTGAAGGAAGG - Intronic
1165906203 19:39196361-39196383 CAGAGTGGGGAGGGGGAGGAGGG + Intergenic
1166766488 19:45254350-45254372 CAGGGCAGCCAGCTGGAGGTGGG - Intronic
1166934311 19:46321800-46321822 CAGGGAAGGCGGGTGCAGGAAGG - Exonic
1166942061 19:46373221-46373243 CAGGGAGGGGAGGTGGTGGAAGG + Intronic
1167381394 19:49140236-49140258 CAAGGTAGGCGGGAGGAGGAGGG + Intronic
1167474543 19:49692144-49692166 CTGGGTATGAAGGAGGAGGAGGG + Intronic
1167600377 19:50451387-50451409 GAGGATAGGCAGGGCGAGGAAGG + Intronic
1167669774 19:50844079-50844101 CAGGTTTCTCAGGTGGAGGATGG + Intergenic
1168105035 19:54161252-54161274 GAGGGTAAGCTGGTGGGGGAAGG + Exonic
1168124976 19:54278040-54278062 CAGGAGAGGCGGGTGGAGGGAGG - Intronic
1168177011 19:54633515-54633537 CAGGAGAGGCGGGTGGAGGGAGG + Intronic
1168191216 19:54739987-54740009 CAGGGTAGACATGAGGTGGAGGG - Intronic
1168193476 19:54756592-54756614 CAGGGTAGACATGGGGTGGAGGG - Intronic
1168195539 19:54771330-54771352 CAGGGTAGACATGGGGTGGAGGG - Intronic
1168307498 19:55443314-55443336 CAGGGGAGGCAGCTGGAGGGAGG + Intergenic
925135035 2:1521267-1521289 CAGCGTGGGAAGGTGCAGGAGGG - Intronic
925319119 2:2948606-2948628 CAGGCTAGGCAAGGGGAGCAGGG + Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925902094 2:8515957-8515979 CTGTGTGGGGAGGTGGAGGAGGG - Intergenic
926052672 2:9754723-9754745 GAGGGTGGGCAGGGGCAGGAGGG + Intergenic
926105444 2:10146721-10146743 AAGGGTAGGGAGGAGGAGGAGGG + Intronic
926142662 2:10377604-10377626 CACGGGAGCCAGGGGGAGGAGGG - Intronic
926163116 2:10501934-10501956 GAGGAAAGGCTGGTGGAGGAGGG - Intergenic
926228179 2:10983247-10983269 CAGGGCAGGGAGGTGGGAGAGGG - Intergenic
926306665 2:11642017-11642039 GAGGGTAGGCAAGTGGGAGAAGG - Exonic
926803395 2:16682619-16682641 AAGAGTGGGCAGGTTGAGGAGGG + Intergenic
927156101 2:20222747-20222769 CTGGGGAGGCAGGTGGAGTTTGG - Intronic
927916302 2:26938839-26938861 CAGGGGAGTCAGGTGGGGGAGGG - Intronic
928204127 2:29271988-29272010 AGGGGTAGGGAGGTTGAGGAAGG + Intronic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
928400932 2:30978216-30978238 CAGTTTGGGCAGCTGGAGGAGGG - Intronic
929056844 2:37885688-37885710 GAGGGTAGGGAGGAGGAGGTTGG - Intergenic
929983653 2:46704434-46704456 TATGGTAGGTAGTTGGAGGAAGG + Intronic
931262225 2:60630392-60630414 CAGGTTAGGAGAGTGGAGGAGGG - Intergenic
931671095 2:64648645-64648667 CAGGCTGGGGAGGTTGAGGAAGG - Intronic
932528056 2:72494331-72494353 GAGGCCAGGCAGGTGGGGGATGG + Intronic
933278497 2:80306684-80306706 AAGGGTTGGGAGGTGGGGGAGGG + Intronic
933698603 2:85238285-85238307 CAGGGCAGGCAGCGGGAGGCGGG + Intronic
933738115 2:85511669-85511691 CAGGGCTGGCAGGTTGAGAAAGG - Intergenic
933780849 2:85799854-85799876 CAGGGCAGGCAGGTGGGGCGGGG - Intergenic
933993672 2:87651757-87651779 CAGGCTTGGCAGGTGGTGGTAGG + Intergenic
934039477 2:88116018-88116040 CAGGAGAGGCTGGTGCAGGATGG + Intergenic
934041571 2:88131361-88131383 CAGGGTAGGCAGGAAGTGCAGGG - Intergenic
934501492 2:94863186-94863208 CAGGTCAGACAGGTGGAGGAGGG - Intergenic
934739932 2:96712891-96712913 CAGGGTAGTGAGGTGGTGAAGGG + Intronic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935526068 2:104169102-104169124 TAGGGTGGGGAGGTTGAGGAGGG - Intergenic
935885707 2:107617142-107617164 AAGGGTACCCAGGTAGAGGATGG + Intergenic
936300191 2:111299126-111299148 CAGGCTTGGCAGGTGGTGGTAGG - Intergenic
936528343 2:113257593-113257615 CAGGGGAGGGAGATAGAGGATGG + Intronic
937149088 2:119673639-119673661 CGGGGTAGGGAGGAGGAGGGGGG - Intergenic
937538116 2:122915964-122915986 GAGGGTAGGAAGTGGGAGGAGGG + Intergenic
938070108 2:128303942-128303964 CAGAACAGGAAGGTGGAGGAAGG + Intronic
938095116 2:128456516-128456538 AAGGGGAGGCAGGGGGATGAGGG - Intergenic
938467391 2:131532647-131532669 CAGGGCAGGCAGATGGGGGCGGG + Exonic
938689447 2:133774142-133774164 CAGGCTAATCAGCTGGAGGAGGG - Intergenic
938970219 2:136424707-136424729 CAGGGGAGGCAGCAGGACGAAGG + Intergenic
939009157 2:136825456-136825478 CAGGCTTTGAAGGTGGAGGAAGG - Intronic
939678216 2:145098286-145098308 TGAGTTAGGCAGGTGGAGGAAGG - Intergenic
939984179 2:148814021-148814043 CAGGCTGGGCAGGAGGAAGAGGG - Intergenic
940485862 2:154294914-154294936 CAGGGTAGAAAGGTGGGAGAAGG + Intronic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
942612253 2:177754577-177754599 CAGGGGAGGAAGGTGAAGGAAGG - Intronic
943029667 2:182670820-182670842 GAGGGGAGGCGGGTGGTGGATGG + Intergenic
943657965 2:190529316-190529338 CTGGGAGGGAAGGTGGAGGAGGG - Intronic
944162501 2:196679320-196679342 CAGGGGAAGGAGGTGGAAGAAGG - Intronic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
946186998 2:217986658-217986680 CAGGGAAGGCATGTGCAGGTTGG - Intronic
946189813 2:218002280-218002302 CAGGGGAGGGCTGTGGAGGAAGG + Intronic
946973382 2:225120515-225120537 CAGGGTAGGCAGGCAGAGGAAGG - Intergenic
947521282 2:230848006-230848028 CCGGGAAGGAAGGCGGAGGAGGG + Intergenic
947746124 2:232508210-232508232 CTGGGTAGGCTGAGGGAGGAGGG + Intergenic
947874195 2:233457718-233457740 CAGGGCAGGCACATGGAGGATGG + Intronic
1168866739 20:1093001-1093023 TAGGGCAGGAAGGTGGAGGAAGG + Intergenic
1168996718 20:2138648-2138670 CTGGGGAGGCAGGTCCAGGAGGG + Intronic
1169081405 20:2799661-2799683 TAGAGGAGGCAAGTGGAGGAGGG - Intronic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1170271407 20:14531095-14531117 CAGGGAAGGTAGGAGGAGGAGGG + Intronic
1170458621 20:16556045-16556067 CAGTGTTGGAAGGGGGAGGATGG - Intronic
1170708105 20:18764208-18764230 CAGCTTTGGGAGGTGGAGGAAGG + Intergenic
1170722448 20:18895609-18895631 CATGGTAGGGACGTGGTGGAAGG + Intergenic
1170906566 20:20520515-20520537 CAGGGTGGGCAGGTGTTGAAAGG - Intronic
1170952724 20:20951514-20951536 TAGGGTTGGCATGTGCAGGAAGG - Intergenic
1171373592 20:24676808-24676830 CAGGGGAGGCCGGTGCAGGCAGG - Intergenic
1171396336 20:24836220-24836242 GAGGGTGGGCAGGTGGAGGGTGG - Intergenic
1171396347 20:24836250-24836272 GAGGGTAGGCAGCTGGAGGGTGG - Intergenic
1172180607 20:33001184-33001206 CAGGGAAGGCAGGGGGAGGGTGG - Intronic
1172573978 20:35992744-35992766 CAGGGTCGGGGGGTGGGGGAGGG - Intronic
1172771701 20:37386009-37386031 CAGGGAAGGCATGGGCAGGATGG - Intronic
1173408803 20:42791396-42791418 CAGGGTTGGCAGGAGAAGGTGGG + Exonic
1173896475 20:46554874-46554896 CAGGGCAGGGAGGAGGAGCATGG - Intergenic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1174064103 20:47852264-47852286 CAGGGTGGGATGGTGGAGGTGGG + Intergenic
1174450746 20:50618591-50618613 CAGGGTAAGCAGGCAGAGGCAGG - Intronic
1175170767 20:57079892-57079914 CAGGGAAGGAAGGGGGAGGCAGG - Intergenic
1175179538 20:57135778-57135800 CAGGGGAGGCAGGTGCAAGGTGG + Intergenic
1175954718 20:62603458-62603480 CAGGGTTGGCAAGAAGAGGAAGG - Intergenic
1176148064 20:63574183-63574205 CAGGGCAGGCAGCTCCAGGAGGG - Intronic
1176257268 20:64158869-64158891 CAGGTGGGGCAGGTGGAGGTAGG - Intronic
1176270518 20:64233451-64233473 AAGGGGAGGAAGGTGGGGGAAGG - Intronic
1176312189 21:5157980-5158002 TAGGGGAGGCGGGTGGGGGAGGG - Intergenic
1176598236 21:8767587-8767609 TGGGGTGGGCAGGGGGAGGAGGG - Intergenic
1176624509 21:9082043-9082065 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1178668481 21:34569545-34569567 CAGGGTAGGCAGGTGGAGGAAGG - Intronic
1178900042 21:36591477-36591499 CAGGGGAGCCAGGTGGGCGATGG - Intergenic
1179091069 21:38266278-38266300 CAGGGTGGGAAGCTAGAGGAGGG - Intronic
1179094157 21:38296941-38296963 CATGGTAGCCAGGTGGGTGAAGG + Exonic
1179485379 21:41706714-41706736 CAGGGGAGGGAGCTGGAGGTGGG - Intergenic
1179654677 21:42837787-42837809 CAGGGTTGGCAGAGGGCGGAGGG - Intergenic
1179844859 21:44104050-44104072 TAGGGGAGGCGGGTGGGGGAGGG + Exonic
1179874899 21:44262509-44262531 CAGGGTGGGTGGGTGGAGGGCGG + Intergenic
1179929534 21:44558156-44558178 CTGGGCTGGCAGGTGGAGGCAGG + Exonic
1179931673 21:44574905-44574927 CTGGGTTGGCAGGAGGAGGTGGG - Exonic
1179972021 21:44841328-44841350 GAGGGTCGCCAGGTGGAGGCTGG - Intergenic
1180048060 21:45318749-45318771 CAGGGCAGGAAGGGGCAGGATGG - Intergenic
1180048904 21:45322411-45322433 TGGGGTAGGCAGGTGCAGGAAGG - Intergenic
1180148902 21:45937691-45937713 CAGGGTTTGCAGGTGCAGGTGGG + Intronic
1181109379 22:20592258-20592280 CAGGGTGGGCAGCTGGGGCAGGG + Intergenic
1181971198 22:26691365-26691387 CTGGGTAGGTTGGAGGAGGATGG + Intergenic
1182044577 22:27264226-27264248 AAAGGAAGGCAGGTGGAGGGAGG + Intergenic
1182844835 22:33421834-33421856 GGGGGTAAGCAGGTGGAAGAGGG + Intronic
1182886425 22:33777720-33777742 AAGGGAAGGCAGGTGAAGGGAGG + Intronic
1183228499 22:36566197-36566219 CAGGGGAGGAAGGTGGTGGGGGG - Intronic
1183442266 22:37830026-37830048 GAGGGGAGGCAGGGGCAGGAGGG - Intergenic
1183543101 22:38441239-38441261 GAGGGAAGCCAAGTGGAGGAGGG - Intronic
1183601424 22:38842695-38842717 CAGGGTAGGGAGGTGGTGAGGGG + Intronic
1183987653 22:41578267-41578289 CAGGAGAGGTAGGGGGAGGACGG + Intronic
1184248838 22:43249013-43249035 CAGGGGGTGCTGGTGGAGGAAGG + Intronic
1184282093 22:43443100-43443122 CAGGGTAGGCTGGTGGTGACTGG + Intronic
1184389230 22:44193373-44193395 CAGCGTAGGGAGGGAGAGGATGG + Intronic
1184555917 22:45233040-45233062 CAGATCAGGAAGGTGGAGGAAGG + Intronic
1184567610 22:45301558-45301580 CAGGGTGGGCAGGGGTGGGATGG - Intergenic
1184652596 22:45925962-45925984 CAGGGGAGGGAGGAGGGGGAGGG - Intronic
1184832151 22:46995743-46995765 CAGAATCCGCAGGTGGAGGAAGG - Intronic
1184912705 22:47547084-47547106 CAGGGCAGCCGGGTGAAGGAGGG - Intergenic
1184981029 22:48096245-48096267 CAGGGTGGGGAGGTGCAGGCGGG + Intergenic
1185013655 22:48331287-48331309 CTGGGTAGGCAGGTGGGGCAAGG - Intergenic
1185326653 22:50228892-50228914 GAGAATAGGCAGGTGGATGATGG - Intronic
949466510 3:4349848-4349870 AAGGGAAGGAAGTTGGAGGATGG + Intronic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
950122761 3:10492715-10492737 CAGGAAAGGCAGGTGGATCAAGG + Intronic
950168894 3:10822588-10822610 CAGGGGAGGGAGGTTGGGGAAGG + Intronic
950219831 3:11186043-11186065 CAAGGTGGGCAGGAGGAGCAAGG - Intronic
950536341 3:13581202-13581224 CAGGGGCGGCAGGTGGGGGGTGG + Intronic
950584715 3:13883955-13883977 CAGGGTAGACAGGATAAGGAAGG + Intergenic
951149964 3:19277197-19277219 AAGGGGAGGCAGGGGGATGAAGG + Intronic
951941137 3:28079998-28080020 CTGGCTAGGCAGGAAGAGGAAGG - Intergenic
952958449 3:38575246-38575268 CAGGGACGGCTGGAGGAGGAGGG - Intronic
953422154 3:42762463-42762485 CAGGGTAGGCTGGAGGGGGCTGG + Intronic
954425247 3:50439717-50439739 CAGGGTCTGCAGTTGGAGGCCGG + Intronic
954432945 3:50480907-50480929 AAGGGGAGGAAGGGGGAGGAAGG + Intronic
954539501 3:51384464-51384486 CCGGGGAGGCAGGAGGAGGCTGG + Intergenic
954689805 3:52389652-52389674 CAGGGTAGGAAGGAGGCAGAAGG - Intronic
954781654 3:53066372-53066394 CAGCCTTGGCAGGTGGAGGCAGG + Intronic
954852754 3:53617310-53617332 GAGGGGAGGCAGGAGGAGGTAGG + Intronic
955059551 3:55483680-55483702 CAGAGGAGTGAGGTGGAGGAGGG + Intronic
955229660 3:57087413-57087435 TAAGCTAAGCAGGTGGAGGAGGG - Intergenic
955921940 3:63966301-63966323 CAGGGAGGGCAGGTGAAGTAGGG + Intronic
956790262 3:72674607-72674629 CAGGGAAGGCAAGTGAAGGTTGG + Intergenic
956847338 3:73195671-73195693 CAGGGTGGGGAGTGGGAGGAAGG - Intergenic
957430634 3:80101172-80101194 CATTGTAGGCAGGAGGAAGAAGG + Intergenic
958139520 3:89543401-89543423 CAGGATAGCCAACTGGAGGATGG + Intergenic
959089331 3:101885597-101885619 CGGGGTAGGGGGCTGGAGGAGGG - Intergenic
959330365 3:104997003-104997025 GAGGGTAGGGTGGTGGAGGTCGG - Intergenic
960361413 3:116716368-116716390 CAGTTTGGGGAGGTGGAGGAGGG + Intronic
960673074 3:120170547-120170569 GAGGAGAGGCTGGTGGAGGAGGG - Intronic
960945770 3:122965462-122965484 CAAGGGAGGAAGGTGGAGAAAGG - Intronic
961036316 3:123644424-123644446 CAGGGGAGGCATGGGGTGGAGGG + Intronic
961940938 3:130636896-130636918 GAGGGGAGGAAGGGGGAGGAAGG - Intronic
962266028 3:133944919-133944941 CAGGGTAGGGAGGTAGAGAGAGG + Intronic
962292487 3:134148151-134148173 CAGGGGAGGAAGATGTAGGATGG - Intronic
962941099 3:140125402-140125424 CCGGGTGGGCATGGGGAGGAGGG + Intronic
962948990 3:140200800-140200822 AAGAGGAGGCAGGTGGGGGAGGG - Intronic
963043287 3:141084478-141084500 CAGGGCAGGCAGGGGGAGGGGGG - Intronic
963081136 3:141394637-141394659 CTGGATAGGCTGGTGAAGGAAGG - Intronic
964162354 3:153660513-153660535 CAGGGAGGGAAGGGGGAGGATGG - Intergenic
964655979 3:159066590-159066612 CAGGGCAGTCAGGTGGAGTGGGG + Intronic
966435126 3:179875497-179875519 CAGGTGAGGCAGGTGGCGGCAGG + Intronic
966594191 3:181711767-181711789 CGGGGGAGGCCGGGGGAGGAGGG - Intergenic
966847980 3:184145184-184145206 CAGGCCCGGCAGTTGGAGGAAGG + Exonic
968226684 3:196976823-196976845 CACTGTAGGAAGCTGGAGGATGG + Intergenic
968584051 4:1407752-1407774 CTGCGTGGGCAGGAGGAGGAGGG - Intergenic
968593978 4:1473070-1473092 CAGGGTGGGCAGGTGGGGGGTGG - Intergenic
968622504 4:1610277-1610299 CAGGGGAGGCAGCTGGAGTCTGG - Intergenic
968653697 4:1769831-1769853 CAGGGAAGTCAGGTGGAGTAAGG + Intergenic
968659613 4:1793640-1793662 CAGGGAGGGAAGGGGGAGGAGGG + Intronic
968728327 4:2258485-2258507 CAGGGAAGGCAGGTGGCTGGTGG - Intronic
968915946 4:3497139-3497161 GAGGGCAGGCTGCTGGAGGATGG + Intronic
968940876 4:3637005-3637027 CAGGGTTGGCAAGTGCTGGACGG - Intergenic
968943924 4:3653768-3653790 GAGGGCAGGCAGGCAGAGGAAGG - Intergenic
969130058 4:4984402-4984424 CAGGTGGGGCAGGTGGGGGAAGG + Intergenic
969279540 4:6160873-6160895 CAGGGTAGGCGAGTGGAGGTCGG - Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969440276 4:7212862-7212884 CAGGGTGAGGAGTTGGAGGAGGG + Intronic
969480398 4:7443889-7443911 CAGGCCAGGGAGGTGGAGGCTGG - Intronic
969607157 4:8208084-8208106 GAGGGTTGCCAGGTGGAGGATGG - Intronic
969689109 4:8694554-8694576 CAGGGAGAGCAGGTGGAGGAAGG + Intergenic
969696895 4:8740075-8740097 CAGGCTGGGCAGGGGGAGGGTGG + Intergenic
969810051 4:9640675-9640697 ATGGCTGGGCAGGTGGAGGAGGG - Intergenic
970007031 4:11421345-11421367 CTGGGTAGGAAGGAGGGGGAGGG - Intronic
970155469 4:13137261-13137283 AAGGGTCTGCAGGTTGAGGAAGG + Intergenic
970641321 4:18069488-18069510 CAGGGAAGAGAGGTGGAGGGAGG - Intergenic
971258482 4:25034672-25034694 AAGGGCAGGCAAGTGCAGGAGGG + Intergenic
971453321 4:26820326-26820348 AGGGGTGGGCAGGTGGAGAAGGG - Intergenic
971889995 4:32507705-32507727 CAGGGTAGGCACTTGGTGGGAGG - Intergenic
972247275 4:37258662-37258684 GAGTGTCAGCAGGTGGAGGAAGG + Intronic
972733799 4:41820135-41820157 GAGGGTGGGAAGGTGGAAGAAGG + Intergenic
973565678 4:52184826-52184848 CTGGGGGGGCAGGTGGAGGCAGG - Intergenic
977762707 4:100758913-100758935 CATTGTGGGCAGGTGGAGGTAGG + Intronic
978838602 4:113183221-113183243 GAGGGGATGGAGGTGGAGGAGGG + Intronic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
982206182 4:152998914-152998936 CTGGGGAGGAAGGTGGAGGGAGG + Intergenic
982370442 4:154627424-154627446 CAGGGGAGGGAGACGGAGGAAGG - Intronic
982541190 4:156673695-156673717 CAGGCTAGCCTGCTGGAGGATGG + Intergenic
982545162 4:156724472-156724494 CATGGGAGGGAGGTGGAGGTGGG + Intergenic
984095305 4:175426876-175426898 CAGGGTAGGCAGCTTATGGAAGG - Intergenic
984637885 4:182133019-182133041 CAGGCGAGTCAGGAGGAGGAGGG + Intergenic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985348060 4:189027938-189027960 CAGGGCTAGCAGGTGGAGGGTGG - Intergenic
985487126 5:158192-158214 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487145 5:158233-158255 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985619245 5:945191-945213 CAGAGGAGGCAGGAGGAGCATGG - Intergenic
985620438 5:952210-952232 CAGGGGAGGGAGGTGGGGGGTGG - Intergenic
986011077 5:3715853-3715875 ATGGGGAGGCAGGTGGACGAGGG - Intergenic
986788545 5:11138533-11138555 CAGGTTGGGCAGGGAGAGGATGG - Intronic
987103483 5:14613774-14613796 CAGACTAAGCTGGTGGAGGATGG + Intronic
987172026 5:15269143-15269165 CAGGGTAAGCTGGTTTAGGATGG + Intergenic
987785037 5:22488733-22488755 CAGGGTAAGCAGGTTTAGGATGG - Intronic
988497710 5:31758910-31758932 CAGGGAACGCATGTGGAGGCGGG - Intronic
989201903 5:38772295-38772317 TAGGCGAGGCAGGTGGAGAATGG + Intergenic
989955536 5:50354929-50354951 CAAGGTAAGCAGGTTTAGGATGG - Intergenic
991194534 5:63917165-63917187 GAGAGTAGGAAGGGGGAGGATGG - Intergenic
991227827 5:64293023-64293045 CAGAGTAGACAGGGTGAGGAGGG - Intronic
991612517 5:68464023-68464045 CAGGTTTGGTAGGTGGTGGAAGG + Intergenic
991638816 5:68733324-68733346 CTGGGCAGGCAGGTGGGGCAAGG - Intergenic
991956258 5:71998398-71998420 CAGCAGAGGCTGGTGGAGGAAGG + Intergenic
992134669 5:73732221-73732243 AAGGGTTGGTAGGTGGGGGAGGG - Intronic
992187677 5:74259881-74259903 TAGGGAATGGAGGTGGAGGAGGG - Intergenic
992625628 5:78633737-78633759 CAGGGTAGGGAGGTGGAGATGGG + Intronic
992808353 5:80360896-80360918 AAGGTTAGGCAGGCAGAGGAGGG - Intergenic
993038702 5:82787481-82787503 CAGAGTAAAAAGGTGGAGGAAGG + Intergenic
994139196 5:96323030-96323052 CAAGGTAGGCAGGTTAAGCAGGG - Intergenic
995567046 5:113441644-113441666 CAGGGTAGGGGGTTAGAGGAGGG - Intronic
996449765 5:123607583-123607605 CAGGGCAGGGAAGAGGAGGATGG + Intronic
996915508 5:128707532-128707554 CAGGGAAGGGATCTGGAGGAAGG - Intronic
997334843 5:133099951-133099973 CAGGGAATGCAGCTGGAGCAGGG + Intronic
997368033 5:133338356-133338378 CAGGGTGGGAAGATGGAGCATGG - Intronic
998068688 5:139179560-139179582 TAGGGTAGGCAGGTAGGGGGTGG + Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998462518 5:142320323-142320345 GGGGGTAGGGAGGTGGGGGAAGG - Intronic
999044957 5:148457078-148457100 CAGGCTAGGCAGGCAGAGGGGGG - Intronic
999510866 5:152250475-152250497 CAGGGTAAGCGGGTGGTGGGAGG - Intergenic
999904791 5:156128582-156128604 CAAGGTAGGGACCTGGAGGAAGG + Intronic
1000339431 5:160266031-160266053 CAGGGTAGGCTGGTGGCTGCTGG - Intronic
1000906878 5:166974929-166974951 CTGGGGAGGGGGGTGGAGGAGGG + Intergenic
1001293768 5:170484767-170484789 GAGGGTGGAAAGGTGGAGGAGGG - Intronic
1001486487 5:172123204-172123226 CAGGGCAGGCATCTGCAGGAAGG + Intronic
1001689822 5:173624727-173624749 CCGGGTAAGTAGGTGGAGGAAGG + Intergenic
1001806503 5:174591306-174591328 GAGAGAAGGCAGGTGGAGAATGG - Intergenic
1001845595 5:174918153-174918175 AAGGGGAGGAAGGTGGAGGGAGG - Intergenic
1001970826 5:175953784-175953806 CGGGGCAGGCAGGGTGAGGATGG - Intronic
1002001129 5:176196810-176196832 CTGGGTGTGCATGTGGAGGAAGG - Intergenic
1002246612 5:177889980-177890002 CGGGGCAGGCAGGGTGAGGATGG + Intergenic
1002253206 5:177942162-177942184 CTGGGTGTGCATGTGGAGGAAGG + Intergenic
1002458839 5:179362397-179362419 CAGGGGAGCCAGGTGATGGAGGG + Intergenic
1002493936 5:179599268-179599290 CAGAGTGGGCAGCTGGTGGAGGG + Intronic
1002772882 6:304328-304350 CAGGGTGGGCAGGCGGGGCAGGG + Intronic
1002862564 6:1093370-1093392 CTGGGGAGGTAGGTGGAGCAAGG - Intergenic
1002924290 6:1595833-1595855 GAGGGTGGGAAGGCGGAGGAGGG - Intergenic
1003016013 6:2468122-2468144 GAGGGTAGACAGGGAGAGGAAGG + Intergenic
1003557650 6:7155200-7155222 CAGGGCAGGCAGATGGATGATGG - Intronic
1003558121 6:7158551-7158573 AAGGGTATGGAGGTGGAGGCTGG - Intronic
1004191930 6:13471459-13471481 GAGGGAAGGCGGGTGGAGCAGGG + Intronic
1004899928 6:20184341-20184363 GAGGGGGGACAGGTGGAGGACGG + Intronic
1006093951 6:31644386-31644408 CAGGGAGGGCAGCTGGATGAGGG + Intronic
1006144305 6:31949148-31949170 CAGGGTGAGCAAGTTGAGGAAGG - Intronic
1006149890 6:31981364-31981386 CTGGGGAGGCTGGTGAAGGAGGG + Exonic
1006156191 6:32014102-32014124 CTGGGGAGGCTGGTGAAGGAGGG + Intergenic
1006185026 6:32176641-32176663 CAGAGAAGGCAGGTGGAGGGGGG - Exonic
1006303329 6:33205377-33205399 CTGGGGAGGGAGTTGGAGGAGGG + Intronic
1006384677 6:33723773-33723795 GAGGGGAGCCTGGTGGAGGAGGG + Intronic
1006576170 6:35048108-35048130 CAGGCTAGGCTGGTGGAGAGAGG - Intronic
1006717324 6:36128931-36128953 CAAGGTGGGCAGGTGGGGGGAGG - Intronic
1006735067 6:36267710-36267732 AAGGGTAAGCAGGCGGAGGAGGG - Intronic
1007158681 6:39771234-39771256 CAGGGTAGGGTGGAGGAGGATGG - Intergenic
1007290655 6:40783638-40783660 CAGGGCAGGGTGGAGGAGGATGG + Intergenic
1007388384 6:41534893-41534915 GAGGGTAGGCAGGGTAAGGATGG - Intergenic
1007398474 6:41590353-41590375 CAGGGCAGGTAGGAGGAGGGTGG + Intronic
1007472414 6:42099431-42099453 CTGGGTAGGCAGGTGGGGGCAGG + Intergenic
1007505336 6:42331435-42331457 AAGTGCAGGCAGGTGGAGGGAGG - Intronic
1007790685 6:44306577-44306599 CAGGGTGGGGAGGTGGGGGTGGG - Intronic
1008720184 6:54339532-54339554 CTGGGTAGGCGGGTTGAGGGGGG + Intronic
1008863233 6:56176903-56176925 AAGGGGAGGAAGGGGGAGGAAGG + Intronic
1008951263 6:57162187-57162209 TAGGGTAGGAATGTGGAGGCTGG + Intronic
1009999045 6:70929198-70929220 CAGGGTAGGGAGAGGGGGGAGGG + Intronic
1010194522 6:73225744-73225766 GAGGGTATGGAGGTGCAGGAAGG + Intronic
1010464329 6:76149228-76149250 GAGGGTAGGGAGCTGGGGGAGGG + Intergenic
1012666338 6:101975706-101975728 CAAGGTGGGCAGGTGGAGTCAGG + Intronic
1012963403 6:105646784-105646806 CAGGGTAAGCATGTAGAGGCAGG - Intergenic
1012980998 6:105830870-105830892 AAAGGGAGGCAGCTGGAGGAGGG + Intergenic
1013423390 6:109987333-109987355 CAGGCTTGACAGGAGGAGGATGG + Intergenic
1013926037 6:115473689-115473711 CAGGGGTGGGAGGAGGAGGAAGG + Intergenic
1014391657 6:120872380-120872402 CAGGGTCAGCAGGTTGATGATGG + Intergenic
1014554715 6:122831635-122831657 CAGGGTAGAAAGGTGGAAAAAGG - Intergenic
1015836522 6:137426122-137426144 CAGGGGAGGAAGGTGGAATAAGG + Intergenic
1015849004 6:137552410-137552432 AAGGGAAGGAAGGGGGAGGAAGG - Intergenic
1015942308 6:138464401-138464423 CAGGGCAGGAAGGCCGAGGATGG + Intronic
1016016036 6:139187156-139187178 CTGGGTAGGGAGGTGCAGGGGGG - Intergenic
1016181533 6:141153613-141153635 CAGGGTAGGGGGGCGGGGGAGGG - Intergenic
1017143662 6:151214719-151214741 AAGGGTATGCAGGTGGAAAAGGG + Intergenic
1017492758 6:154958781-154958803 CAGGGTGGGCAGCAGGATGAAGG - Intronic
1018787454 6:167119167-167119189 CCAGGTAGGCAGGGGGAGGAAGG - Intergenic
1018908761 6:168089979-168090001 CAGCCTGAGCAGGTGGAGGATGG - Intergenic
1018998203 6:168726036-168726058 CAGAGGAGGCAGTGGGAGGAGGG + Intergenic
1019325968 7:438429-438451 CAGTGAAGGCAGGTGGGGCACGG - Intergenic
1019384453 7:746677-746699 CAGGGTGGGCAGGGGGTGGCAGG - Intronic
1019406360 7:886172-886194 CCGGGCAGGCAAGTGGAGGTGGG + Intronic
1019453508 7:1112385-1112407 CAGAGTGAGCAGGTGGAGGCCGG - Intronic
1019539807 7:1546533-1546555 CAGGCTGGGCAGCTGGAGGGAGG - Exonic
1019788878 7:2997424-2997446 CAGGGGAGGCAGGGCGAGGATGG + Intronic
1019851052 7:3557994-3558016 CAGGGTCGGGGGGTGGGGGAGGG - Intronic
1020262057 7:6536261-6536283 CTGGGGAGGCTGCTGGAGGAAGG - Intronic
1020283509 7:6663701-6663723 GAGGGAAGGGAGGTGAAGGAGGG + Intergenic
1020741879 7:12030326-12030348 CAGGACAGGAGGGTGGAGGAAGG + Intergenic
1020812496 7:12864267-12864289 CAGGGGAGGCAGGCCAAGGAGGG - Intergenic
1022012053 7:26316708-26316730 GAGGGTAAGCAGGTGGACCAGGG + Intronic
1022102386 7:27176110-27176132 CAGGGTGCGGAGGAGGAGGATGG + Intronic
1022141832 7:27499594-27499616 CAGAGCAGGCAGGTCCAGGAGGG - Intergenic
1022342955 7:29486020-29486042 CAGGCTGGGCAGGAGGTGGAAGG - Intronic
1022797314 7:33742429-33742451 CAGGGTAGGCAGGAGGTTAATGG + Intergenic
1023125386 7:36949792-36949814 CTGGGTGGGGTGGTGGAGGAGGG - Intronic
1023506711 7:40907041-40907063 CAGGGTAGGAAGATGGAAGTAGG + Intergenic
1023556585 7:41429874-41429896 AAGAGTAGGCTGGAGGAGGAGGG - Intergenic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1024019547 7:45353358-45353380 CAGGGGAGGGAAGAGGAGGAAGG + Intergenic
1024681398 7:51693367-51693389 TAGAGCAGGCAGGTGGAAGAGGG + Intergenic
1025251390 7:57353645-57353667 CAGGGTAGGTAGGTGGGGCCTGG + Intergenic
1026255478 7:68707596-68707618 CTGGACAGGCAGGTGGTGGAGGG - Intergenic
1026442003 7:70453007-70453029 CAGGATAGGGAGGTGGGGAAGGG - Intronic
1026571234 7:71532959-71532981 CAGGGTTTGTAGGTGGAGGTGGG - Intronic
1026742250 7:72986186-72986208 CAGGAAAGGCAGATGGGGGAGGG - Intergenic
1026769277 7:73184059-73184081 TTGGGTGGGCAAGTGGAGGAAGG + Intergenic
1026796112 7:73367076-73367098 CAGGGCTGGCAGGTGGAGAGGGG - Intergenic
1026802098 7:73406606-73406628 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1026806137 7:73430474-73430496 AAGGGGAGGGAGGGGGAGGAGGG - Intergenic
1027010147 7:74737442-74737464 TTGGGTGGGCAAGTGGAGGAAGG + Intronic
1027028374 7:74870925-74870947 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027077895 7:75208593-75208615 TTGGGTGGGCAAGTGGAGGAAGG - Intergenic
1027101485 7:75378892-75378914 CAGGAAAGGCAGATGGGGGAGGG + Intergenic
1028342122 7:89734632-89734654 GAGGGTAGAGAGTTGGAGGAAGG + Intergenic
1028415925 7:90580574-90580596 CAGGGTAAGTAGGTGGAGAGTGG - Intronic
1029211294 7:98910238-98910260 CAGGGGTGGCAGGTGGGGGTGGG - Exonic
1029250608 7:99233507-99233529 CAAGGAAGGCAGGTGGTGCAGGG - Intergenic
1029412850 7:100426865-100426887 CAGGGAAGGGAGGAGGGGGAGGG - Intronic
1030170610 7:106599156-106599178 CAGGGTAGGCAGGGAGAGGAAGG - Intergenic
1031536289 7:122937235-122937257 AAGGGTTGGAAGGTGGAGGTTGG - Intergenic
1031918135 7:127582267-127582289 CAGGATCGGCTGCTGGAGGAGGG - Exonic
1032123581 7:129174564-129174586 CAGGCTTGGAAGATGGAGGATGG - Intergenic
1032150605 7:129426455-129426477 AAAGGTAGGCAGGTGTAGGCTGG - Exonic
1032283406 7:130523972-130523994 GAGGGTGGGTAGGTGGAGGCGGG + Intronic
1032284148 7:130528198-130528220 GAGGGTGGGCAGGTGGAGTGGGG + Intronic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1032738160 7:134711865-134711887 CAGGCAAGGTTGGTGGAGGAGGG + Intergenic
1033210372 7:139455665-139455687 CAGGGTGGGGACGTGGTGGAGGG + Intronic
1033399948 7:141013203-141013225 CAAGATAGCCAGGAGGAGGAAGG + Intronic
1033405941 7:141072031-141072053 GAGGGAGGGCAGGTGGAGGTGGG + Intergenic
1034098462 7:148431064-148431086 CAGGGTTGGGAGCTGGGGGAGGG + Intergenic
1034275514 7:149822150-149822172 CTGGGTGTCCAGGTGGAGGAAGG - Intergenic
1034457079 7:151176362-151176384 CAGGGTAGGCTGGTGAGGGGTGG + Intronic
1035308059 7:157945919-157945941 CAGGGTAGGGATGTCCAGGAAGG - Intronic
1036037158 8:5031969-5031991 CAGGTGAGGCAGGTGGTGAAGGG + Intergenic
1036090239 8:5657278-5657300 CAGAGAAGCCAGGTGAAGGAAGG - Intergenic
1036258488 8:7222829-7222851 CATGGTGGGCAAGGGGAGGAAGG + Intergenic
1036308132 8:7616679-7616701 CATGGTGGGCAAGGGGAGGAAGG - Intergenic
1036310543 8:7681425-7681447 CATGGTGGGCAAGGGGAGGAAGG + Intergenic
1036358988 8:8064680-8064702 CATGGTGGGCAAGGGGAGGAAGG - Intergenic
1036409329 8:8484275-8484297 CAGGGGAAGCAGGTTAAGGAAGG - Intergenic
1036561751 8:9904678-9904700 CAGTGTGGAGAGGTGGAGGAGGG - Intergenic
1036754687 8:11464448-11464470 CATGGTGGGCAGGGGGAGGTGGG - Intronic
1037319853 8:17632026-17632048 CAGGGATGGCACGCGGAGGATGG - Intronic
1037926442 8:22847258-22847280 CAGGGTAGGATGGGAGAGGATGG - Intronic
1037959921 8:23089211-23089233 CAGGGTAGAAAGTGGGAGGAGGG + Intronic
1037960181 8:23091913-23091935 CAGGATGGGCAGGTGCTGGAGGG + Intronic
1039854307 8:41399131-41399153 CCTGGAAGCCAGGTGGAGGAAGG - Intergenic
1039931984 8:42001015-42001037 GAGGGAAGGAAGGAGGAGGAAGG + Intronic
1039953676 8:42191259-42191281 CACCGTAGGCAGGTGGTGGGTGG + Intronic
1040989628 8:53335917-53335939 CAGAGTAGGCAGATGGGGGGTGG - Intergenic
1041421705 8:57674008-57674030 CAGGGCAGCAAGGTGGAGGGAGG - Intergenic
1041624307 8:60007806-60007828 GAGGGTAGGGAGTGGGAGGAGGG + Intergenic
1041709553 8:60881447-60881469 CAGGCTTTGCAGATGGAGGAAGG - Intergenic
1041714426 8:60921441-60921463 CCGGGAGGGCAGGGGGAGGAGGG - Intergenic
1043398123 8:79858141-79858163 CTGGGAAGCCAGGTGGAGAATGG - Intergenic
1043778195 8:84297198-84297220 GAGGGTAGACAGTGGGAGGAGGG - Intronic
1044169696 8:89034194-89034216 GAGGGGAGGAAGGAGGAGGAGGG + Intergenic
1045038230 8:98194252-98194274 CTGGGTAGGCGGGGTGAGGAAGG + Intronic
1045085766 8:98682859-98682881 TAGGGTAGGAAGGTGGAAGGAGG - Intronic
1045357464 8:101402443-101402465 CAGTGTAGGCAGCTAGTGGAGGG + Intergenic
1045900996 8:107279939-107279961 CAGTGTAGGGAGGTTGAGAAGGG + Intronic
1047480104 8:125273953-125273975 CAGAGGAGGCACCTGGAGGAGGG - Intronic
1047646823 8:126878547-126878569 CATGGCAGGCAGGTGGAGGAAGG + Intergenic
1048303104 8:133265831-133265853 CAGGGTAGGCATGGGGTGAAGGG - Intronic
1048839221 8:138550242-138550264 CAGGGGAGGCACCTGGTGGAAGG + Intergenic
1048985699 8:139733630-139733652 CAAGGCAGGCAGGTGGAATAAGG + Intronic
1049002050 8:139832463-139832485 CAGGGGAGGCTGGTGGGGGTGGG + Intronic
1049016459 8:139923511-139923533 GAGGTTAGCCAGGTGGAGGTGGG - Intronic
1049091243 8:140515463-140515485 CAGGGTGGGCCTGTCGAGGAGGG - Exonic
1049113507 8:140665320-140665342 CAGGGTTGGCAGTTGGAGCCAGG - Intronic
1049337418 8:142093804-142093826 CGGGGTAGACAGGGAGAGGAAGG + Intergenic
1049421055 8:142516918-142516940 CAGGGAAGTCAGGTGGCTGAAGG - Intronic
1049421362 8:142517995-142518017 GCGGGTGGGGAGGTGGAGGAGGG + Intronic
1049554467 8:143275171-143275193 TAGGGGATGCAGGAGGAGGAGGG - Intronic
1049770256 8:144376817-144376839 CTGGGTAGGCAGCAGGTGGATGG + Intronic
1049782562 8:144435597-144435619 CCGGGCAGGCAGGTGTAGGGTGG - Intronic
1049798510 8:144507199-144507221 AAGGGTAGGCAGGTGGGAGCGGG - Intergenic
1049818695 8:144621110-144621132 CAGGGCAGGCAGCTGCAGGCTGG - Intergenic
1049988319 9:971856-971878 GAGGGCAGGCGGGTGGGGGAGGG - Intergenic
1050236562 9:3587271-3587293 CAGGGGAGGGAGCTGGTGGAAGG + Intergenic
1051671517 9:19515351-19515373 CAGGGTACTCTGGTGGAGGTGGG + Exonic
1053723494 9:40973358-40973380 CAGGGTAGGCAGGTGAGGTGGGG - Intergenic
1054342469 9:63878638-63878660 CAGGGTAGGCAGGTGAGGTGGGG + Intergenic
1055053374 9:72001271-72001293 AGGGGTGGGCAGGTGGGGGAAGG + Intergenic
1056272350 9:84958680-84958702 CTGGGTAGGGAAGTGAAGGATGG + Intronic
1056765765 9:89443578-89443600 TGGGGTAGGCGGGTGGCGGACGG + Intronic
1056827025 9:89883598-89883620 CAGGGCAGGGAGGTGGAGGGAGG - Intergenic
1057076159 9:92139171-92139193 CAGGGAAGGCATATGGAGAAAGG + Intergenic
1057173687 9:92978713-92978735 GAGGGGAGGGGGGTGGAGGAAGG - Intronic
1057226785 9:93296849-93296871 GAGGGGAGGAAGGTGAAGGAAGG - Intronic
1057389066 9:94627936-94627958 CAGGGGAGGGAGGTAGGGGAAGG - Intronic
1057884779 9:98822070-98822092 CAAACTAGGCAGGAGGAGGAGGG - Intronic
1058873353 9:109221229-109221251 GAGGGGAGGGAGGGGGAGGAAGG + Intronic
1059352709 9:113676940-113676962 CTGGGGGGGCAGGTGGAGGTGGG + Intergenic
1059812733 9:117874033-117874055 CAGCGTAGGCAGGGGGAGCAGGG + Intergenic
1059916964 9:119114716-119114738 CAGGGTTGAGAGGTGCAGGAGGG + Intergenic
1060295151 9:122338296-122338318 CAGGATAGGAGGCTGGAGGATGG - Intergenic
1060481988 9:124021901-124021923 CTGGGTGGGCAGGTGGGGGCGGG + Intronic
1060869815 9:127030539-127030561 CAGGGAAGGCAGGTAGGAGAGGG + Intronic
1060888727 9:127174916-127174938 CTGGGCAGGCTGGTGCAGGAGGG - Intronic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061177529 9:129006702-129006724 CAGTGTAGGCTGGTGGAGAGGGG - Exonic
1061201476 9:129140796-129140818 TAGGGTGGGGAGGTGGGGGAGGG + Intronic
1061326831 9:129869263-129869285 CCGGCCAGGCAGGTGGAGGCTGG + Intronic
1061386966 9:130296105-130296127 CAGGGCTGGCAGGAAGAGGAGGG + Intronic
1061665854 9:132160985-132161007 CATGGGAGGCAGGTGTGGGAGGG - Intergenic
1061975548 9:134066663-134066685 CAGGGTAGGGCGGGGGAGGACGG + Intronic
1062068151 9:134540001-134540023 CTGGGTAGGGAGGTGGAAGAGGG - Intergenic
1062215301 9:135385894-135385916 CAGGGTGGGCACGGGGAGGGTGG - Intergenic
1062343416 9:136103836-136103858 CAGGGTGGACAGGTGGAGTGTGG - Intergenic
1062389283 9:136327625-136327647 CAGGGCGGGCAGGGGGCGGACGG + Exonic
1203747685 Un_GL000218v1:52475-52497 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1203562058 Un_KI270744v1:65511-65533 CAGGTCAGATAGGTGGAGGAGGG - Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1187094446 X:16131620-16131642 CAGGATCTGTAGGTGGAGGAAGG - Intronic
1187724732 X:22190608-22190630 CAGGGTATGCTGGTGAAGGAAGG + Intronic
1188029676 X:25250507-25250529 GAGGGTGGGGAGTTGGAGGAGGG - Intergenic
1188065645 X:25656329-25656351 CTGGGTTAGGAGGTGGAGGAGGG - Intergenic
1188242956 X:27810990-27811012 CAGAGTATGCAGTTGGAGGGAGG - Intronic
1189909351 X:45794421-45794443 CAGGGGTGGTAGGTGGAGGAGGG + Intergenic
1190212660 X:48460408-48460430 CAGGGTAGTCAGTTGGAGGGAGG - Intronic
1190281953 X:48936970-48936992 CAGGGTAGGAAGGGGAAGGCAGG - Intronic
1190336225 X:49264050-49264072 CTGGGAAGGCAGGTGGGGGAAGG + Intronic
1191137781 X:57084094-57084116 CAGAGTAGACAAGTGAAGGAAGG + Intergenic
1191659432 X:63634831-63634853 CAGGGTGGGCAGGTCAAGGCTGG + Intergenic
1192200053 X:69060947-69060969 CAGGGTTGGAAGGGGCAGGAAGG - Intergenic
1194744202 X:97610633-97610655 GATGGTAGGAAGCTGGAGGAAGG - Intergenic
1195065773 X:101236958-101236980 CATGGTAGGAAGCTGGAGGCTGG - Intronic
1196058017 X:111377096-111377118 AAGTGGAGGCAGGAGGAGGAGGG - Intronic
1197415130 X:126165379-126165401 CAGGGTGGGCAGCTGGTAGATGG + Exonic
1197580276 X:128274559-128274581 AAGGGTAGGAAGGTGGGAGAGGG + Intergenic
1197652556 X:129081752-129081774 CAGGCTAGCCATGTGGAAGATGG + Intergenic
1197862596 X:130986337-130986359 GAGGGTAGAGAGTTGGAGGAGGG - Intergenic
1199073904 X:143509246-143509268 GAAGGAATGCAGGTGGAGGAAGG + Intronic
1199215422 X:145255565-145255587 GAAGGAATGCAGGTGGAGGAAGG - Intronic
1199714430 X:150496209-150496231 CTGGGAAGGCAGGTGGGGGTTGG + Intronic
1200893812 Y:8353434-8353456 CAGGCTTGGGAGGTTGAGGAAGG - Intergenic
1201161017 Y:11167460-11167482 CAGGTCAGACAGGTGGAGGAGGG + Intergenic