ID: 1178669109

View in Genome Browser
Species Human (GRCh38)
Location 21:34575317-34575339
Sequence AAGGAGGAAAGGAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13900
Summary {0: 2, 1: 13, 2: 343, 3: 2093, 4: 11449}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178669109 Original CRISPR AAGGAGGAAAGGAGGGAAGT GGG (reversed) Intronic
Too many off-targets to display for this crispr