ID: 1178675558

View in Genome Browser
Species Human (GRCh38)
Location 21:34628656-34628678
Sequence GATGGAGTAAAGCGCCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178675552_1178675558 10 Left 1178675552 21:34628623-34628645 CCCCAAGGTGAGTGGCAGCTCTA No data
Right 1178675558 21:34628656-34628678 GATGGAGTAAAGCGCCTGTCTGG No data
1178675554_1178675558 8 Left 1178675554 21:34628625-34628647 CCAAGGTGAGTGGCAGCTCTAAG No data
Right 1178675558 21:34628656-34628678 GATGGAGTAAAGCGCCTGTCTGG No data
1178675553_1178675558 9 Left 1178675553 21:34628624-34628646 CCCAAGGTGAGTGGCAGCTCTAA No data
Right 1178675558 21:34628656-34628678 GATGGAGTAAAGCGCCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178675558 Original CRISPR GATGGAGTAAAGCGCCTGTC TGG Intergenic
No off target data available for this crispr