ID: 1178677204

View in Genome Browser
Species Human (GRCh38)
Location 21:34641340-34641362
Sequence TTTCTATGTTGAGGGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178677204_1178677208 14 Left 1178677204 21:34641340-34641362 CCAGCACTCCCTCAACATAGAAA No data
Right 1178677208 21:34641377-34641399 GTTTTATGAAATGAGTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178677204 Original CRISPR TTTCTATGTTGAGGGAGTGC TGG (reversed) Intergenic
No off target data available for this crispr