ID: 1178678211

View in Genome Browser
Species Human (GRCh38)
Location 21:34648895-34648917
Sequence TGCAATCATGCCAGTGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178678207_1178678211 25 Left 1178678207 21:34648847-34648869 CCACTGGGTTATTTGTCAGCTGT No data
Right 1178678211 21:34648895-34648917 TGCAATCATGCCAGTGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178678211 Original CRISPR TGCAATCATGCCAGTGGAGT GGG Intergenic
No off target data available for this crispr