ID: 1178679729

View in Genome Browser
Species Human (GRCh38)
Location 21:34663713-34663735
Sequence TTTTTCATCTGGAACAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178679729_1178679733 12 Left 1178679729 21:34663713-34663735 CCCTCACTGTTCCAGATGAAAAA No data
Right 1178679733 21:34663748-34663770 CATATAGTTATTACGAGATAGGG No data
1178679729_1178679734 16 Left 1178679729 21:34663713-34663735 CCCTCACTGTTCCAGATGAAAAA No data
Right 1178679734 21:34663752-34663774 TAGTTATTACGAGATAGGGCAGG No data
1178679729_1178679732 11 Left 1178679729 21:34663713-34663735 CCCTCACTGTTCCAGATGAAAAA No data
Right 1178679732 21:34663747-34663769 TCATATAGTTATTACGAGATAGG No data
1178679729_1178679735 17 Left 1178679729 21:34663713-34663735 CCCTCACTGTTCCAGATGAAAAA No data
Right 1178679735 21:34663753-34663775 AGTTATTACGAGATAGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178679729 Original CRISPR TTTTTCATCTGGAACAGTGA GGG (reversed) Intergenic
No off target data available for this crispr