ID: 1178680542

View in Genome Browser
Species Human (GRCh38)
Location 21:34669662-34669684
Sequence GGTGCCGAGGTGCCCCAAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178680536_1178680542 -3 Left 1178680536 21:34669642-34669664 CCGAGGAGGGAGCCCCGGAGGGT 0: 1
1: 1
2: 1
3: 28
4: 224
Right 1178680542 21:34669662-34669684 GGTGCCGAGGTGCCCCAAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178680542 Original CRISPR GGTGCCGAGGTGCCCCAAGG AGG Exonic
900125768 1:1068417-1068439 GGCGCCGAGATGGCCCCAGGTGG - Intergenic
901012060 1:6207630-6207652 GGGGCCAAGGTGCCCTAGGGAGG - Intronic
901292474 1:8134953-8134975 GGTGAAGAGGTGGCCCAAAGAGG - Intergenic
901436124 1:9248386-9248408 GGGGCCGAGGTGCCACAGTGAGG + Intronic
902863597 1:19262853-19262875 GGTGCTGAGGGGTCCTAAGGTGG - Intergenic
903647763 1:24905139-24905161 GGTGGTGGGGTGTCCCAAGGGGG + Intronic
905303169 1:36999262-36999284 GGTGCCCAGGTGCACCGAGGTGG + Intronic
907392741 1:54168808-54168830 GTGGCCCAGGTGGCCCAAGGAGG - Intronic
915463981 1:156085232-156085254 GGTGCAGAGGAGGCCCAGGGTGG + Intronic
918399168 1:184146334-184146356 GGTGGGAAGGTACCCCAAGGTGG - Intergenic
919808342 1:201394236-201394258 GATGCCGAGGCGCACAAAGGGGG + Intronic
920535194 1:206732556-206732578 GGTGCTGCCGTGCCCCCAGGAGG + Exonic
922110205 1:222548526-222548548 AGTGCTGAAGGGCCCCAAGGCGG + Intergenic
922496864 1:226063609-226063631 TGTGCCGAGGGACCCGAAGGAGG + Intronic
924775286 1:247111713-247111735 GGTGCCTACGAGCTCCAAGGCGG - Exonic
1063964477 10:11336046-11336068 GGTGCTGCGGTATCCCAAGGTGG - Exonic
1066198423 10:33124198-33124220 GATGCCGAGGTGGGCCAAGGTGG - Intergenic
1069937439 10:71927436-71927458 GGTGGCCAGGTGCCCCAGTGTGG - Intergenic
1077492571 11:2868917-2868939 GGTGCTCTGGGGCCCCAAGGAGG - Intergenic
1081701544 11:45155622-45155644 GGTGCAGGGGTGCCTCAAGGAGG + Intronic
1083572803 11:63769103-63769125 GGCGCTGAGATGCCCCGAGGGGG - Intergenic
1083591056 11:63895160-63895182 GGAGTCAAGGTGTCCCAAGGTGG - Exonic
1086782856 11:90929376-90929398 GGTGCAGAAGTGCCCCAGGTAGG - Intergenic
1096188360 12:49598751-49598773 GGTGACCATGTTCCCCAAGGTGG - Exonic
1097237169 12:57548516-57548538 GGTCCCCAGGGGCTCCAAGGTGG - Intergenic
1104498839 12:129265660-129265682 GGTGTTGAGGAGCCCCAAGCAGG - Intronic
1106009431 13:25804735-25804757 GGTGCCGAGCTGCCACAGGCTGG + Intronic
1107389067 13:39944537-39944559 GGTGGTGAGGTGGCACAAGGAGG - Intergenic
1114032503 14:18588921-18588943 GGTGCCTAGGTGCCCACCGGGGG - Intergenic
1114077285 14:19167947-19167969 GGTGCCTAGGTGCCCACCGGGGG - Intergenic
1114084880 14:19231617-19231639 GGTGCCTAGGTGCCCACCGGGGG + Intergenic
1118350743 14:64971512-64971534 GGTTCTGTGGTGACCCAAGGTGG - Intronic
1119330034 14:73786955-73786977 GGTGCCGGGGTGCTGCAGGGAGG - Intronic
1119379265 14:74218352-74218374 GGTGCCAGCCTGCCCCAAGGTGG + Intergenic
1122802364 14:104238074-104238096 GGTGCCGAGGTGGGCACAGGAGG + Intergenic
1202896481 14_GL000194v1_random:13428-13450 GGTGCCTAGGTGCCCACTGGGGG + Intergenic
1123696426 15:22882172-22882194 GGTCCCGGGGTGCCACAATGAGG + Intronic
1125608693 15:40956805-40956827 CCTGCCCAGCTGCCCCAAGGAGG + Intergenic
1128242415 15:66110007-66110029 GGTGCAGAGGGGCCCCGGGGTGG + Intronic
1129459465 15:75693281-75693303 GGAGGCGAGGTGCCGCAAAGAGG + Intronic
1129724499 15:77894615-77894637 GGAGGCGAGGTGCCGCAAAGAGG - Intergenic
1132000881 15:98179133-98179155 AGGGCGGAGCTGCCCCAAGGAGG + Intergenic
1135158330 16:20073038-20073060 GGGGCAGAGGTGCCCCAAGTGGG + Intronic
1141338609 16:83181398-83181420 GGTGCCCAGGTGCCCCATAAAGG + Intronic
1142880368 17:2878773-2878795 GCTGCCCAGGAGCCCCACGGTGG + Intronic
1144872427 17:18379433-18379455 GGGGCTCAGGTGCCCCAGGGAGG - Intronic
1146356899 17:32142315-32142337 GGGGTCGCGGTGCCCAAAGGAGG + Exonic
1147323676 17:39660330-39660352 GGTGCCGAGGGGCCCTCTGGTGG + Intronic
1151748835 17:76025589-76025611 GGGGCTCAGGTGCCCCAGGGAGG + Intronic
1152697876 17:81805496-81805518 GTTCCCGAGGTGCCCAATGGGGG - Intronic
1152721005 17:81923821-81923843 GGTGCACAGGGGCCCCACGGGGG + Intronic
1156213865 18:34977106-34977128 GGTGTCGGGGTGCGCCAGGGCGG - Intronic
1161202880 19:3025627-3025649 TGGGCCCAGGTGCCCCAAAGAGG + Intronic
1163672639 19:18637566-18637588 GGTGCTGAAGGGCCCCAAGGTGG + Intronic
1163927956 19:20363243-20363265 GGAGCCCAAGTCCCCCAAGGGGG + Intergenic
1163958112 19:20662594-20662616 GGTGCAGAGCTGCCCAAAGTGGG + Intronic
1164095995 19:22010538-22010560 GGTGCAGAGCGGCCCCAAGAGGG + Intronic
1164115495 19:22215393-22215415 GGTGCAGAGCTGCCCCAAGAGGG + Intergenic
1164199171 19:23002770-23002792 GGTGCAGAGCGGCCCCAAGAGGG + Intronic
1164296541 19:23915229-23915251 GGTGCAGAGCTGCCCAAAGAGGG - Intronic
1165992985 19:39826646-39826668 GGTGCCCAGGTGCCCAAATGGGG - Intronic
1168121574 19:54254987-54255009 GGTGCAGCCGGGCCCCAAGGTGG - Exonic
926696159 2:15771310-15771332 GGTGCTGAGGAGACCCAGGGTGG + Intergenic
927095769 2:19746800-19746822 GCTGCCAGGGTGGCCCAAGGTGG + Intergenic
929857639 2:45650372-45650394 AGTGCCGAAGTCCCCCAAAGGGG + Intergenic
931515995 2:63051026-63051048 CGCGCCGAGGGGCCGCAAGGGGG - Intronic
935085080 2:99837278-99837300 TGTGCAGAGGTGCCCAGAGGGGG + Intronic
936523981 2:113230392-113230414 GGTCCAGAGGTGCCCCCACGGGG + Intronic
942560420 2:177213024-177213046 GCGGGCGAGGGGCCCCAAGGAGG - Intronic
946693574 2:222329563-222329585 GGTGCCAAGGTCACTCAAGGGGG - Intergenic
947027934 2:225760015-225760037 GGTGACAAGGAGCCCCAGGGTGG - Intergenic
947502752 2:230683432-230683454 GGTGCCCAGAGGCCCAAAGGGGG - Intergenic
948455433 2:238102436-238102458 GGTCCCGAGATGCCCCCAGGTGG - Intronic
948728950 2:239951541-239951563 GGTGCTGAGGGGACCCAGGGAGG - Intronic
948786705 2:240356415-240356437 GAAGCAGAGGTGCCCCAATGCGG + Intergenic
948887078 2:240889784-240889806 GGTGCCGTGGTGCCGCAGGCTGG - Intronic
1171123618 20:22584570-22584592 AGTGCCGAGCTGCCCCGAGGCGG + Intronic
1174426151 20:50432831-50432853 GGTGCTGAGGTGACCCCATGAGG - Intergenic
1175515382 20:59566783-59566805 GGTGCCGGGGTGCAGCAGGGAGG - Intergenic
1176110061 20:63407049-63407071 GGAGCCGTGGTCCCCCACGGGGG + Exonic
1176408873 21:6437048-6437070 GATGCAGAGGAGCCCCAAGCAGG - Intergenic
1176616167 21:9029424-9029446 GGTGCCTAGGTGCCCACTGGGGG + Intergenic
1176708991 21:10134313-10134335 GGTGCCTAGGTGCCCACCGGGGG - Intergenic
1178680542 21:34669662-34669684 GGTGCCGAGGTGCCCCAAGGAGG + Exonic
1179684365 21:43045370-43045392 GATGCGGAGGAGCCCCAAGCAGG - Intergenic
1180056775 21:45362963-45362985 GGTGACGCTGAGCCCCAAGGAGG - Intergenic
1180158626 21:45989451-45989473 GGTGCCGAGGCCCTCCAAGGTGG - Intronic
1180166658 21:46033957-46033979 GGTGCCGGGGGGACCCAACGCGG + Intergenic
1180293090 22:10861576-10861598 GGTGCCTAGGTGCCCACCGGGGG - Intergenic
1180456614 22:15515978-15516000 GGTGCCTAGGTGCCCACCGGGGG - Intergenic
1180495895 22:15890998-15891020 GGTGCCTAGGTGCCCACCGGGGG - Intergenic
1181039140 22:20183779-20183801 TGTGCCCAGGTGCCCCAGGCAGG - Intergenic
1181132719 22:20742861-20742883 GGTGCCTCGCTGCCCCAAAGTGG + Intronic
1181798378 22:25327065-25327087 GGGGCAGGGGTGCCACAAGGTGG + Intergenic
1183667101 22:39252449-39252471 GGTCCCCTGGTGCCCCAAGGGGG - Intergenic
1184779166 22:46637743-46637765 GGTGCCCAGGGGCCCCAGGATGG - Intronic
950090458 3:10290961-10290983 GGTGGCGGGGTGCCCCAAGTGGG + Exonic
961406319 3:126682242-126682264 GGTGCCAAGCCTCCCCAAGGAGG + Intergenic
963568761 3:146964856-146964878 GGTGCCTAGGTGACCCATGTTGG + Intergenic
968008848 3:195260196-195260218 GGTGCAGCGGCGCCCCCAGGCGG + Intronic
968575617 4:1364748-1364770 GGGGTGGAGGTGCCCCAGGGTGG - Intronic
968956909 4:3724157-3724179 GGTGCAGCTGTGCCCCAAGAAGG + Intergenic
980464219 4:133152181-133152203 GGCGCCGTGGAGCCCCAGGGCGG + Exonic
987089576 5:14498920-14498942 GGGGCCCTGGTGCCCCATGGTGG - Intronic
995926431 5:117380550-117380572 AGTGCAGAGGTGACACAAGGGGG + Intergenic
999575111 5:152967398-152967420 GGTGCCGAGGTCCATGAAGGTGG - Intergenic
999751089 5:154628679-154628701 GGTTCCCTGATGCCCCAAGGGGG + Intergenic
1005994985 6:30925589-30925611 GGTGCCCAGGGGCTCCAAGAAGG - Exonic
1006295387 6:33167812-33167834 GGTTCCGAGGGGCGACAAGGAGG - Exonic
1007473504 6:42105208-42105230 GGTGCCCAAGTTACCCAAGGAGG - Exonic
1011425814 6:87228693-87228715 GGTGCCAAGGTGACTCAATGGGG - Intronic
1015843235 6:137494561-137494583 GGAGCAGAGGTGTCCCAGGGCGG - Intergenic
1016013190 6:139159474-139159496 GGTACCTGGGTGCCACAAGGAGG + Intronic
1017039293 6:150294895-150294917 GGGGTGGAGGTGCCCCAGGGAGG + Intergenic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1022298066 7:29075575-29075597 GGGTCTGAGGTCCCCCAAGGTGG + Intronic
1022486624 7:30784078-30784100 GGTGTCGAGCTGCCAAAAGGTGG + Intronic
1024995536 7:55270935-55270957 GGTGTGGGGGTGCCTCAAGGAGG - Intergenic
1029557237 7:101278895-101278917 GCTGCAGAGGGGACCCAAGGGGG + Intergenic
1031605497 7:123763290-123763312 GCTGCGCAGGAGCCCCAAGGCGG + Intergenic
1032780156 7:135158811-135158833 GCTGCCGAGCTGCTTCAAGGAGG - Intronic
1034224416 7:149471690-149471712 GGTGAAGAGGTGCCCCAAGCTGG + Intergenic
1034656604 7:152734725-152734747 GGTGCAGAGGTGGCACAAAGAGG + Intergenic
1034830599 7:154304846-154304868 GGGGCAGAGGTGGCCCCAGGAGG - Intronic
1034958942 7:155352305-155352327 GGTGCTGCGATGCCCCAAGGCGG - Intergenic
1038354693 8:26816694-26816716 GGCGCTGAGGTGCCACATGGAGG - Intronic
1039903078 8:41767008-41767030 GCCGCCGGGGTGCCCCGAGGGGG - Intronic
1040501492 8:48008783-48008805 GGAGGCGAGGAGGCCCAAGGTGG + Intronic
1045179575 8:99765622-99765644 GATGCAGAAGTGCCCCCAGGGGG + Intronic
1048953273 8:139513622-139513644 GGTGCTGAGGAGACCCAGGGTGG - Intergenic
1049647517 8:143742287-143742309 GGTGATGAGGTGCCCCCCGGGGG + Intergenic
1053645964 9:40119832-40119854 GGTGCCTAGGTGCCCACTGGGGG - Intergenic
1053759752 9:41343708-41343730 GGTGCCTAGGTGCCCACTGGGGG + Intergenic
1054326975 9:63717729-63717751 GGTGCCTAGGTGCCCACTGGGGG - Intergenic
1054538606 9:66256144-66256166 GGTGCCTAGGTGCCCACTGGGGG + Intergenic
1062242703 9:135548675-135548697 GGTGGCCAGGTGAGCCAAGGTGG - Intronic
1202793751 9_KI270719v1_random:103283-103305 GGTGCCTAGGTGCCCAGCGGGGG - Intergenic
1193467923 X:81869405-81869427 AGTAGAGAGGTGCCCCAAGGTGG - Intergenic
1196755161 X:119151061-119151083 AGTGCCGAGCTGCCCCCACGTGG - Intergenic
1200070598 X:153527191-153527213 GGAGGAGAGGTGCCCCAAGTCGG - Intronic
1201149550 Y:11088148-11088170 GGTGCCTAGGTGCCCACCGGGGG + Intergenic