ID: 1178685459

View in Genome Browser
Species Human (GRCh38)
Location 21:34707226-34707248
Sequence GGCACTTATAATTGTGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178685456_1178685459 12 Left 1178685456 21:34707191-34707213 CCTGCAATGATTTTGCATGTGCA 0: 1
1: 0
2: 1
3: 8
4: 129
Right 1178685459 21:34707226-34707248 GGCACTTATAATTGTGAGACTGG 0: 1
1: 0
2: 0
3: 6
4: 70
1178685455_1178685459 25 Left 1178685455 21:34707178-34707200 CCGTTCTTATCAACCTGCAATGA 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1178685459 21:34707226-34707248 GGCACTTATAATTGTGAGACTGG 0: 1
1: 0
2: 0
3: 6
4: 70
1178685454_1178685459 30 Left 1178685454 21:34707173-34707195 CCTGACCGTTCTTATCAACCTGC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1178685459 21:34707226-34707248 GGCACTTATAATTGTGAGACTGG 0: 1
1: 0
2: 0
3: 6
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178685459 Original CRISPR GGCACTTATAATTGTGAGAC TGG Intronic