ID: 1178686803

View in Genome Browser
Species Human (GRCh38)
Location 21:34718274-34718296
Sequence CTTGAAACCTAAATGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 241}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178686803_1178686808 13 Left 1178686803 21:34718274-34718296 CCATTCTCCATTTAGGTTTCAAG 0: 1
1: 0
2: 0
3: 14
4: 241
Right 1178686808 21:34718310-34718332 GGTATGGGCTTCTTTTAAAATGG 0: 1
1: 0
2: 1
3: 6
4: 199
1178686803_1178686805 -8 Left 1178686803 21:34718274-34718296 CCATTCTCCATTTAGGTTTCAAG 0: 1
1: 0
2: 0
3: 14
4: 241
Right 1178686805 21:34718289-34718311 GTTTCAAGAAATAAAATGAATGG 0: 1
1: 2
2: 5
3: 123
4: 1083
1178686803_1178686810 23 Left 1178686803 21:34718274-34718296 CCATTCTCCATTTAGGTTTCAAG 0: 1
1: 0
2: 0
3: 14
4: 241
Right 1178686810 21:34718320-34718342 TCTTTTAAAATGGTGAGGACAGG 0: 1
1: 0
2: 0
3: 35
4: 314
1178686803_1178686807 -2 Left 1178686803 21:34718274-34718296 CCATTCTCCATTTAGGTTTCAAG 0: 1
1: 0
2: 0
3: 14
4: 241
Right 1178686807 21:34718295-34718317 AGAAATAAAATGAATGGTATGGG 0: 1
1: 0
2: 4
3: 77
4: 761
1178686803_1178686806 -3 Left 1178686803 21:34718274-34718296 CCATTCTCCATTTAGGTTTCAAG 0: 1
1: 0
2: 0
3: 14
4: 241
Right 1178686806 21:34718294-34718316 AAGAAATAAAATGAATGGTATGG 0: 1
1: 0
2: 5
3: 113
4: 1238
1178686803_1178686811 28 Left 1178686803 21:34718274-34718296 CCATTCTCCATTTAGGTTTCAAG 0: 1
1: 0
2: 0
3: 14
4: 241
Right 1178686811 21:34718325-34718347 TAAAATGGTGAGGACAGGCCTGG 0: 1
1: 0
2: 3
3: 64
4: 623
1178686803_1178686809 18 Left 1178686803 21:34718274-34718296 CCATTCTCCATTTAGGTTTCAAG 0: 1
1: 0
2: 0
3: 14
4: 241
Right 1178686809 21:34718315-34718337 GGGCTTCTTTTAAAATGGTGAGG 0: 1
1: 0
2: 1
3: 18
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178686803 Original CRISPR CTTGAAACCTAAATGGAGAA TGG (reversed) Intergenic
901201430 1:7469543-7469565 CATGAAACCGAAAAGGAAAAGGG - Intronic
903522829 1:23965853-23965875 CTTCAAAAGGAAATGGAGAAGGG + Intronic
903953043 1:27007146-27007168 CTTTAAACCTAATCTGAGAATGG + Intronic
904394276 1:30207852-30207874 CTTGTAACCTACATGGAAGAGGG - Intergenic
904950341 1:34233224-34233246 CTTGAAAGAGAAATGGAGCAGGG - Intergenic
908319348 1:62965311-62965333 CTTGAAACCTCAATATATAATGG + Intergenic
908589343 1:65612969-65612991 TTTAAAACTAAAATGGAGAAAGG - Intronic
909648636 1:77947807-77947829 ATTGAAACATAAATGGGGTATGG - Intronic
910863834 1:91769310-91769332 CTTGAAGCCTCAATGGAGGATGG - Intronic
913684271 1:121216557-121216579 CATGAAGCCTAAGTGGAAAATGG - Intronic
914036110 1:144004172-144004194 CATGAAGCCTAAGTGGAAAACGG - Intergenic
914153348 1:145063773-145063795 CATGAAGCCTAAGTGGAAAATGG + Intronic
916132614 1:161624469-161624491 CCATAAACTTAAATGGAGAAAGG - Exonic
916533587 1:165681696-165681718 CTTAAGACCCAAATGAAGAAAGG + Intronic
916865482 1:168852204-168852226 CTTGAAACCTAAAAGAATACTGG + Intergenic
917215413 1:172673087-172673109 CTTGAAAACTTCCTGGAGAAGGG + Intergenic
917444288 1:175093806-175093828 CTTGAACCCTAAACTAAGAAAGG - Intronic
917557784 1:176109194-176109216 ATTTAAACCCAAATTGAGAAAGG - Intronic
917828540 1:178851243-178851265 ATTCTAACCTAAATGGAGTATGG - Exonic
919244708 1:194966557-194966579 CTTGGAAACTAAATAGAGTAAGG + Intergenic
920471576 1:206235049-206235071 CATGAAGCCTAAGTGGAAAATGG - Intronic
920955703 1:210618697-210618719 CTAGAAACATACATGGGGAAGGG - Intronic
921967971 1:221113077-221113099 CTAGAAACTTGAATGTAGAAAGG - Intergenic
923211095 1:231805181-231805203 ATTGAAACAGAAATAGAGAATGG - Intronic
1063063913 10:2589518-2589540 TTTAAAATCTAAATGGATAATGG - Intergenic
1063304414 10:4883756-4883778 CTTGAACTCTAAAGGGTGAAAGG - Intergenic
1064306522 10:14172221-14172243 CTTGAAACCTAAAAACTGAAGGG + Intronic
1065608018 10:27441216-27441238 GTAGAAAGCTAAATGTAGAATGG + Intergenic
1066934464 10:41809209-41809231 ATTGAAACCTAAGTTGAAAAAGG - Intergenic
1067856624 10:49799214-49799236 CTTGAAACCTGAGTGGTGAAAGG - Intergenic
1068588780 10:58832225-58832247 CTTGAATTCTAAACAGAGAAAGG + Intergenic
1068891577 10:62153930-62153952 GCTGAGACCTAAATGAAGAAAGG + Intergenic
1069176515 10:65295848-65295870 GTTGAAACCTAAATGGATTTAGG - Intergenic
1069289943 10:66766192-66766214 ATTCAACCATAAATGGAGAATGG + Intronic
1069479073 10:68764200-68764222 ATTGAAACCCAGATGGAGCAAGG - Intronic
1071752517 10:88496499-88496521 CTTGAACCAGAATTGGAGAAAGG + Intronic
1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG + Intergenic
1074801064 10:117001913-117001935 GATGAAACCTAAATGGCCAATGG + Intronic
1075339939 10:121638788-121638810 CTGGAAACCTTAGTGGAGAAAGG - Intergenic
1075824051 10:125338343-125338365 GTTAAAACCAAAAAGGAGAAAGG - Intergenic
1079924523 11:26477415-26477437 CTAAAAACATGAATGGAGAAAGG - Intronic
1080893296 11:36427956-36427978 CTTGGTACCTAGATGGAGAGTGG + Intronic
1083248783 11:61451276-61451298 CTAGAAATCTAACTGGAGACCGG + Intronic
1083921599 11:65784057-65784079 GTTGAAACCTGAATGAAGAAAGG + Intergenic
1085646621 11:78227926-78227948 CTAGAAATCTATATGAAGAATGG + Intronic
1086439460 11:86813819-86813841 TTTGGATGCTAAATGGAGAATGG + Intronic
1086882279 11:92162763-92162785 CATGAAAAATAAATGGAAAAAGG - Intergenic
1087584848 11:100105737-100105759 CCAGAACTCTAAATGGAGAATGG - Intronic
1088782667 11:113151181-113151203 CCTGAATCCTAAATGTACAAGGG + Intronic
1092800936 12:12165901-12165923 CTTGAAACTTAGATGCAGAGAGG - Intronic
1093065942 12:14658218-14658240 TTTGAAAACTAAAGGGACAAAGG - Intronic
1093089082 12:14901596-14901618 CTTGATCCCTAAAGAGAGAATGG - Intronic
1094050062 12:26209542-26209564 GATTAAACCTAAATGAAGAAGGG - Intronic
1095737915 12:45577700-45577722 CTTGAAACGAAAACGGAAAAAGG + Intergenic
1097708586 12:62894271-62894293 CATGGAACCAAAAGGGAGAAGGG + Intronic
1097725005 12:63065261-63065283 GTTGAAACGTAAATGAAGAGCGG - Intergenic
1098028851 12:66234084-66234106 GTTGAAAGGTATATGGAGAATGG + Intronic
1098060038 12:66552190-66552212 CCTGAAAGGGAAATGGAGAAAGG + Intronic
1101648811 12:106656120-106656142 CTTGAGACTTAAATTGAAAATGG - Intronic
1103278177 12:119731591-119731613 CATGATACCTAAATGGGGAAAGG - Intronic
1103907089 12:124333272-124333294 CTGGAGACCTGGATGGAGAAAGG + Exonic
1104181630 12:126387086-126387108 CTGGAAATCTTAATGGAGAAGGG - Intergenic
1105128421 13:16900726-16900748 CTTGACACCTAAAGTGAAAAGGG + Intergenic
1105134338 13:16997253-16997275 CTTGACACCTAAAGTGAAAAGGG + Intergenic
1106751694 13:32778060-32778082 TTTAAATACTAAATGGAGAAAGG + Intergenic
1107710468 13:43145894-43145916 CTATAATCCTACATGGAGAAAGG + Intergenic
1109639696 13:65174385-65174407 CCTAAAAGCAAAATGGAGAAAGG - Intergenic
1109797837 13:67340399-67340421 ATCGAAACTTAAATGGGGAAAGG - Intergenic
1111241571 13:85481843-85481865 ATGGAAACTTAAGTGGAGAAGGG - Intergenic
1111931480 13:94517278-94517300 CTTGAAGCCTCATTGGAAAATGG - Intergenic
1112101246 13:96191897-96191919 CTTGAAACCTAAGTAGAGTCAGG + Intronic
1112642367 13:101290355-101290377 TTTGAGACCTAAATGGAATATGG - Intronic
1115033351 14:28826504-28826526 CTTCAAAACTAAAGGGAAAATGG - Intergenic
1115208125 14:30935333-30935355 CTTTTATCCTAAATGGAAAAGGG + Intronic
1119053297 14:71392033-71392055 CTCCAAACCTAAATGGACATAGG - Intronic
1120337348 14:83173888-83173910 CCTGAAACCAAAAAGAAGAATGG - Intergenic
1120342402 14:83238080-83238102 CATGAAAGATAAATGGAAAACGG - Intergenic
1120457465 14:84750713-84750735 CTTTAAACTTTAATGAAGAATGG - Intergenic
1120528375 14:85603867-85603889 CTTGAAACCTGGATTGAGAATGG + Intronic
1120884736 14:89442847-89442869 GTTCAAACCAAAATGGTGAATGG + Intronic
1125156186 15:36589397-36589419 CTTGACAGCAGAATGGAGAAAGG - Intronic
1125896251 15:43304784-43304806 CTTGTAAACTGAATGAAGAAAGG - Intergenic
1126334109 15:47567545-47567567 ATGGAAACCTAAATGAAGAGAGG - Intronic
1128219467 15:65958028-65958050 ATGGAAACCAAAATGGAGAGTGG + Intronic
1128447963 15:67781514-67781536 CTTGAAAATTAAATAGAGGACGG - Intronic
1128927058 15:71666727-71666749 CTTAAAAACTAAATAGAAAACGG + Intronic
1130728877 15:86468879-86468901 CTTGGAACCTAAATGAAGTGGGG + Intronic
1131242980 15:90764156-90764178 CTTGAAACCCTAAAGGACAATGG - Intronic
1131869154 15:96743794-96743816 CTTTAAACCTAGCTGGGGAATGG + Intergenic
1134034594 16:11020170-11020192 CTGGAAGCCAAAATGGAGACTGG - Intronic
1134761950 16:16722389-16722411 TTTGAGAGCTGAATGGAGAATGG + Intergenic
1134984108 16:18636781-18636803 TTTGAGAGCTGAATGGAGAATGG - Intergenic
1135859225 16:26039989-26040011 CTAGACACCTAAATGGGAAATGG + Intronic
1136132375 16:28231470-28231492 GTTGAAACCTGAATGGAATAAGG + Intergenic
1138277943 16:55749926-55749948 CCAGAAACCCCAATGGAGAAGGG + Intergenic
1140575371 16:76161568-76161590 CTTGAAACCTTAATGAATGATGG + Intergenic
1141154384 16:81587116-81587138 TTTGAAACAGAAATGCAGAAGGG + Intronic
1141788915 16:86219684-86219706 TTTGGAATCTAAATGGAGGAGGG + Intergenic
1144223910 17:13126014-13126036 CTTGACACCTAAATGCAATATGG - Intergenic
1146451015 17:32974047-32974069 ATTGAAACTTAAGTGGGGAAGGG + Intronic
1147502111 17:40975570-40975592 ATAGAAACCTCAATGGAGATGGG - Intergenic
1148020393 17:44549390-44549412 CCTGAGATCTAAATGGAGGATGG + Intergenic
1152233654 17:79127232-79127254 CTTGATACCTGAGTGCAGAAAGG + Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1155079488 18:22393685-22393707 CTTAAAACCTAATTGGAGACCGG - Intergenic
1155715484 18:28937561-28937583 GAGGAAACCTAAAAGGAGAAAGG - Intergenic
1155716115 18:28945741-28945763 TTTAAAACCTAAAGGGGGAAAGG + Intergenic
1155813541 18:30272095-30272117 ATTGAAAGATAAATGGAAAAAGG + Intergenic
1156205249 18:34878585-34878607 AATGAAACCTAAATAGATAAGGG - Intronic
1156985088 18:43341614-43341636 GTTGACACCTGAGTGGAGAAGGG + Intergenic
1157358171 18:46954147-46954169 ATTGTAACCTGATTGGAGAAGGG + Intronic
1157947910 18:52001938-52001960 CTTGAAATCTAGATTGTGAAGGG - Intergenic
1159754048 18:72341068-72341090 TTAGAATCCTAAATGCAGAATGG - Intergenic
1164042079 19:21501872-21501894 CTTGAAAGGTAAAAGAAGAAGGG + Intronic
1165004216 19:32791317-32791339 CTGGAAACCTGACTGCAGAAGGG - Intronic
1165975786 19:39675441-39675463 CATGAAACCTGATTGGATAATGG - Intergenic
1166171985 19:41034580-41034602 CTTGAAACTGACAGGGAGAATGG + Intergenic
926903986 2:17788838-17788860 CTTGAAAACTAAAAGGCAAAGGG - Exonic
927075648 2:19574302-19574324 CATGAAAACTCAAAGGAGAAAGG + Intergenic
929115002 2:38436570-38436592 CTAGACACCAAAATGGAGCAAGG - Intergenic
930244000 2:48964763-48964785 CTTTAAACCCAAATGTACAAGGG + Intronic
932189066 2:69723897-69723919 CTTGCAGCTGAAATGGAGAAAGG - Intronic
932589172 2:73053441-73053463 TTTTGATCCTAAATGGAGAAAGG - Intronic
933142383 2:78808747-78808769 CTTGAAAATAAAAAGGAGAAGGG + Intergenic
934983318 2:98865764-98865786 CTTGACACCTTCAGGGAGAAAGG - Intronic
935504715 2:103885953-103885975 CTTAAAACCTAAATGTAAAGGGG + Intergenic
939686988 2:145212434-145212456 CTTGAAAGTTAATGGGAGAATGG - Intergenic
939763555 2:146216108-146216130 CTAGAATCAGAAATGGAGAATGG + Intergenic
941008851 2:160275648-160275670 GTTGAAAGGTATATGGAGAATGG + Exonic
941677070 2:168355246-168355268 CATGAAACCTAAAGGGACTAGGG - Intergenic
941710389 2:168705659-168705681 CTTGAGGCCTAAATTGACAATGG - Intronic
943112540 2:183623444-183623466 ATTGAAACCTCAAGAGAGAAAGG + Intergenic
943434388 2:187846408-187846430 CTTAAAACAGAAATGAAGAAAGG + Intergenic
946708115 2:222479086-222479108 CCTGAAACTGAAATGTAGAAAGG + Intronic
947093109 2:226535896-226535918 CTTCAAAACTAAATGCAAAAAGG - Intergenic
1168937270 20:1676171-1676193 CCTTAAACATAGATGGAGAAGGG - Intergenic
1170543520 20:17412563-17412585 CTTGAAACTGACAGGGAGAATGG + Intronic
1170576974 20:17671613-17671635 CATGACACCTTCATGGAGAAGGG - Intronic
1170956966 20:20990329-20990351 CTAGAACCAAAAATGGAGAAAGG - Intergenic
1171381919 20:24740279-24740301 TTTGAAACCCAAATGGGAAAAGG - Intergenic
1173873110 20:46353946-46353968 CTTGAAACTTAAATGGATGTGGG + Intronic
1175209907 20:57347422-57347444 CTAGAAACAAAAAGGGAGAACGG - Intergenic
1177517494 21:22174706-22174728 CTTGGAAACAAAATGGTGAAAGG - Intergenic
1178568511 21:33712410-33712432 CTTGAAAACTGAACTGAGAAAGG - Intronic
1178686803 21:34718274-34718296 CTTGAAACCTAAATGGAGAATGG - Intergenic
1179201234 21:39223563-39223585 ATTCAAACCTGACTGGAGAAAGG + Intronic
1179343447 21:40533802-40533824 TTTCAAACCTAGATGGAGGAAGG - Intronic
1180866757 22:19124188-19124210 CCTGAAACCTGAAGGGAGGAGGG + Intergenic
950353750 3:12384405-12384427 CTTGATTCCTAAATGGATGATGG + Intronic
952350592 3:32532900-32532922 CTTTAAAATTAAATGTAGAAAGG - Intronic
954593852 3:51807969-51807991 CATTAAACGTAAATGGACAAAGG + Intergenic
955721515 3:61886331-61886353 CTTGAAAACTCAATGCAGAAAGG - Intronic
957135843 3:76287942-76287964 CTTCTAGCCTAAATGGAAAATGG - Intronic
957816781 3:85310628-85310650 CTGGAAAGCTAAAGGGAGCATGG + Intronic
957823508 3:85410067-85410089 CTTGATACATAAAGGAAGAAAGG + Intronic
958056069 3:88413842-88413864 CTTGCAACCTACATGAAAAATGG + Intergenic
963167806 3:142223540-142223562 CCTGAAACCTGAATGGAGGCCGG + Intronic
963179754 3:142341742-142341764 ATGGAAACCAAAATGGAGCAGGG + Intronic
965722998 3:171682555-171682577 CTTGAAACCCAAATTAAGCATGG - Intronic
966625294 3:182009239-182009261 CTGGAAACATAAAAGGAAAAAGG + Intergenic
967034702 3:185639448-185639470 CTTGAGTCCTAAATGGGGGAGGG + Intergenic
967243797 3:187466980-187467002 ATTGAAAACTAAATGGAATAAGG + Intergenic
967353658 3:188543716-188543738 TTTGAAACCTAAATGTGGAGGGG + Intronic
967539057 3:190643283-190643305 CTTGGAAACTAAAAAGAGAAAGG + Intronic
968181906 3:196601662-196601684 CTGGAACCCTAACTGGGGAAAGG - Intergenic
970968090 4:21949951-21949973 ATTGAGACCTACTTGGAGAAAGG - Intergenic
970980340 4:22089045-22089067 CTTGAAAGGTGAATGGTGAAGGG + Intergenic
971525785 4:27616836-27616858 CTTGTTTCCTAAATGAAGAAGGG + Intergenic
972473286 4:39427506-39427528 CTTGATACCAAAATAGAGAAGGG + Intronic
974488111 4:62529874-62529896 CTTGAATTCCAAAGGGAGAAAGG + Intergenic
975833233 4:78392072-78392094 GTTGAAATCTACATGGAGCAAGG + Intronic
976022825 4:80651127-80651149 TTTGCAACCTAAATGGCAAAAGG - Intronic
977163223 4:93662593-93662615 CTAGAAAGCTAATTGGAAAAAGG + Intronic
977557312 4:98498811-98498833 CTTGCAACCTAGAGAGAGAAGGG + Intronic
978544139 4:109852214-109852236 CTTGCATCATAAATGGAGAGAGG + Intronic
978881539 4:113709132-113709154 CTTAAAAACTAAATGGAAAAAGG - Intronic
979217010 4:118177790-118177812 CTTGAAGTCTCAATGAAGAATGG + Intronic
982353368 4:154441179-154441201 CTTAAAAGCTAAATGGAAATTGG + Intronic
982781165 4:159492849-159492871 TTTGAAATCTAAGTGGAGGAAGG - Intergenic
983864575 4:172749437-172749459 CTTCACACATAAATGGAGAGAGG - Intronic
984904495 4:184614213-184614235 TATGAAACCTCCATGGAGAAAGG - Intergenic
986403955 5:7407040-7407062 GTTGAAAACCAAATGGATAAAGG - Intronic
986845653 5:11749875-11749897 CTTGAAACCTAAATATACAAGGG - Intronic
989347997 5:40451908-40451930 CATGAAACTTAAATGTAGATGGG - Intergenic
990056241 5:51582987-51583009 CTTGAAAGCTGAGTGGTGAATGG + Intergenic
994072605 5:95619891-95619913 CTTTACACGTAAATAGAGAATGG + Intergenic
994378239 5:99039145-99039167 CTTGAAAGTGAAAGGGAGAATGG + Intergenic
994729947 5:103480351-103480373 GTTGAAACCTAATTGCAAAAGGG + Intergenic
995566507 5:113436447-113436469 CCTGAAACCTGAAGGGAGGAGGG - Intronic
996984288 5:129539871-129539893 CTGGAAACAAATATGGAGAAAGG - Intronic
997065087 5:130549920-130549942 ATTGAAACTTAAGTGGGGAAGGG - Intergenic
998779351 5:145639340-145639362 CTTGAAAACCAGAGGGAGAAGGG + Intronic
999551723 5:152694886-152694908 CTTTTAACAAAAATGGAGAAGGG - Intergenic
1000477004 5:161722312-161722334 CTTCAAAGCTAAATGCATAATGG + Intergenic
1000823272 5:166011955-166011977 CTAGAAACCAAAATAGAGCAGGG - Intergenic
1001248203 5:170121675-170121697 CTTGAAACCTTTGTGGAAAAGGG - Intergenic
1001275012 5:170344406-170344428 CCTGAACTCTAAACGGAGAAGGG + Intergenic
1002111612 5:176918378-176918400 CTTGGAACCCCACTGGAGAAAGG - Intronic
1003196347 6:3918620-3918642 CCTGAATCCCAAAGGGAGAAAGG + Intergenic
1003898737 6:10633070-10633092 CTTCAAAACTAAATGAATAAGGG + Intergenic
1006233315 6:32604389-32604411 CTGGAAATCTAAAAGGAGCATGG - Intergenic
1007057392 6:38901043-38901065 ATTGAAAAAAAAATGGAGAAAGG - Intronic
1009178733 6:60490981-60491003 CTTGAAAAATAAAGTGAGAATGG - Intergenic
1009535549 6:64878427-64878449 ATTGAAACTTCAATAGAGAAAGG + Intronic
1011388070 6:86818995-86819017 CTTCCAAACCAAATGGAGAAAGG - Intergenic
1012389206 6:98717946-98717968 CTATAACACTAAATGGAGAACGG + Intergenic
1012509178 6:99982849-99982871 CTTGAGTCCAAAAGGGAGAAAGG - Intronic
1016157047 6:140823475-140823497 CTTGAAACCTACAAGCAAAACGG - Intergenic
1020393541 7:7686762-7686784 CTTCACACCTAACTGGAAAACGG - Intronic
1022422100 7:30232906-30232928 CTTGTACCCTAAAGTGAGAATGG - Intergenic
1024107318 7:46106371-46106393 CTTGAGACATAAAAAGAGAAAGG + Intergenic
1027616618 7:80431855-80431877 CTTGAATTCCAAAGGGAGAAGGG + Intronic
1027619404 7:80464992-80465014 CTTGCAAAATAAATGGAGGAAGG + Intronic
1028107450 7:86896567-86896589 CTGGAAACCTGAAGGGAGAGTGG - Intronic
1030260044 7:107554392-107554414 CTTGTAACCACAATGTAGAATGG + Intronic
1030774698 7:113519760-113519782 ATTGAAACTTAAACGGGGAAGGG - Intergenic
1030774878 7:113522266-113522288 CTTCATACCTAAATTGAGATAGG - Intergenic
1031540360 7:122987972-122987994 CTGGTAACATAAATGCAGAAAGG - Intergenic
1040043735 8:42940858-42940880 CCTGAAACCGACAGGGAGAATGG - Intronic
1040131796 8:43805572-43805594 ATTGAGACCTATATGGAAAAAGG + Intergenic
1042189943 8:66176753-66176775 CTTGAAACATAGAGGGAGAGAGG - Exonic
1045816545 8:106283345-106283367 CTGGAACCCTAGATGGAGAGAGG + Intronic
1046152935 8:110252617-110252639 CTTGAAACGTAAAGGATGAATGG + Intergenic
1046389739 8:113554625-113554647 CTTGTAACCACAATGGACAAAGG - Intergenic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1046974877 8:120263214-120263236 TGTGAAACATATATGGAGAATGG - Intronic
1047378003 8:124322377-124322399 ATTGAAACCAAAATGGAAATTGG - Intronic
1047757684 8:127931266-127931288 CTGGAAACATAAATGGAAAAGGG - Intergenic
1047840108 8:128742538-128742560 CTTGAAAACTAAACGTATAATGG + Intergenic
1050794772 9:9524364-9524386 TTTGAGAACTAAATGGTGAAAGG - Intronic
1052275693 9:26673723-26673745 CTTGAAAAGCAACTGGAGAAGGG - Intergenic
1055894980 9:81163957-81163979 CCTGAAAGTTACATGGAGAATGG + Intergenic
1056793875 9:89643350-89643372 GTTGATACCTAAATGGTCAATGG - Intergenic
1056919247 9:90771782-90771804 CTTGAATTCCAAATGGAAAATGG - Intergenic
1057532255 9:95859781-95859803 GTGGAAACCTAAATGGCTAAAGG - Intergenic
1059578906 9:115522222-115522244 CTAGAGACCTAAAAGGAGAGAGG - Intergenic
1060573267 9:124663705-124663727 TTTAAAATTTAAATGGAGAATGG - Intronic
1060803781 9:126562348-126562370 GTTGAAACCTAAACAAAGAAGGG - Intergenic
1186005340 X:5064335-5064357 TTTAAAAACTTAATGGAGAAGGG - Intergenic
1187267787 X:17751799-17751821 CTTGTAACTTCAATGGAGAGGGG - Exonic
1188492224 X:30749775-30749797 ATTGAAACCAATATGGCGAAGGG - Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1190653816 X:52593434-52593456 TTTGAAATCTAAAGGGAAAAAGG - Intergenic
1192231118 X:69265672-69265694 CTTGAAATCAAAATTGTGAATGG - Intergenic
1193613899 X:83665576-83665598 CCTGAAACCAAAGGGGAGAATGG - Intergenic
1195051955 X:101105221-101105243 CTTAAAACATATATGGAGTAGGG + Intronic
1195544341 X:106098639-106098661 CTTGAAGCCTAAATATGGAAAGG - Intergenic
1196970835 X:121106862-121106884 GTTGAAACCTGACTTGAGAAAGG - Intergenic
1197669356 X:129259237-129259259 TTTGAAACTTAAAGGAAGAAGGG - Intergenic
1198226880 X:134653335-134653357 GTTAAAAACCAAATGGAGAAGGG - Intronic
1198387758 X:136145654-136145676 CTTGACTACTATATGGAGAATGG - Intergenic
1199322009 X:146451069-146451091 CCTGAAACATAAATGATGAAAGG - Intergenic
1199421510 X:147649956-147649978 GTTGAAACTTAAATTTAGAAAGG + Intergenic
1199587714 X:149433807-149433829 CTTGAAACCTGAATAGAAGAAGG - Intergenic
1200157858 X:153987064-153987086 CCTGAGACCTAACTGGAGAAGGG - Intergenic
1202108735 Y:21399175-21399197 CTTGAAAACTAGGGGGAGAAAGG + Intergenic