ID: 1178691635

View in Genome Browser
Species Human (GRCh38)
Location 21:34754877-34754899
Sequence ATGGTTTCCCACTTGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178691629_1178691635 16 Left 1178691629 21:34754838-34754860 CCACCTCTCCACATGGGTGTGTC No data
Right 1178691635 21:34754877-34754899 ATGGTTTCCCACTTGCTGCAGGG No data
1178691631_1178691635 8 Left 1178691631 21:34754846-34754868 CCACATGGGTGTGTCTTATCTCC No data
Right 1178691635 21:34754877-34754899 ATGGTTTCCCACTTGCTGCAGGG No data
1178691626_1178691635 25 Left 1178691626 21:34754829-34754851 CCTGTCTCGCCACCTCTCCACAT No data
Right 1178691635 21:34754877-34754899 ATGGTTTCCCACTTGCTGCAGGG No data
1178691630_1178691635 13 Left 1178691630 21:34754841-34754863 CCTCTCCACATGGGTGTGTCTTA No data
Right 1178691635 21:34754877-34754899 ATGGTTTCCCACTTGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178691635 Original CRISPR ATGGTTTCCCACTTGCTGCA GGG Intergenic
No off target data available for this crispr