ID: 1178691672

View in Genome Browser
Species Human (GRCh38)
Location 21:34755064-34755086
Sequence CAGGAAAAGGAGAAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178691662_1178691672 14 Left 1178691662 21:34755027-34755049 CCCTGCCTGTTGCTTGGAAACCC No data
Right 1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG No data
1178691663_1178691672 13 Left 1178691663 21:34755028-34755050 CCTGCCTGTTGCTTGGAAACCCT No data
Right 1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG No data
1178691667_1178691672 -6 Left 1178691667 21:34755047-34755069 CCCTTAGGAATACTTACCAGGAA No data
Right 1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG No data
1178691660_1178691672 30 Left 1178691660 21:34755011-34755033 CCTGGAGTCAATGGGTCCCTGCC No data
Right 1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG No data
1178691668_1178691672 -7 Left 1178691668 21:34755048-34755070 CCTTAGGAATACTTACCAGGAAA No data
Right 1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG No data
1178691664_1178691672 9 Left 1178691664 21:34755032-34755054 CCTGTTGCTTGGAAACCCTTAGG No data
Right 1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178691672 Original CRISPR CAGGAAAAGGAGAAGAAGGA AGG Intergenic
No off target data available for this crispr