ID: 1178696379

View in Genome Browser
Species Human (GRCh38)
Location 21:34796427-34796449
Sequence ACAGAAGAGCTACAGCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 229}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178696379_1178696394 30 Left 1178696379 21:34796427-34796449 CCATCCAGCTGTAGCTCTTCTGT 0: 1
1: 0
2: 1
3: 23
4: 229
Right 1178696394 21:34796480-34796502 AGCAGAAGTGTGGGGGGAGTTGG 0: 1
1: 0
2: 2
3: 47
4: 460
1178696379_1178696392 23 Left 1178696379 21:34796427-34796449 CCATCCAGCTGTAGCTCTTCTGT 0: 1
1: 0
2: 1
3: 23
4: 229
Right 1178696392 21:34796473-34796495 CTGATTCAGCAGAAGTGTGGGGG 0: 1
1: 0
2: 3
3: 46
4: 385
1178696379_1178696389 21 Left 1178696379 21:34796427-34796449 CCATCCAGCTGTAGCTCTTCTGT 0: 1
1: 0
2: 1
3: 23
4: 229
Right 1178696389 21:34796471-34796493 CCCTGATTCAGCAGAAGTGTGGG 0: 1
1: 0
2: 2
3: 7
4: 130
1178696379_1178696391 22 Left 1178696379 21:34796427-34796449 CCATCCAGCTGTAGCTCTTCTGT 0: 1
1: 0
2: 1
3: 23
4: 229
Right 1178696391 21:34796472-34796494 CCTGATTCAGCAGAAGTGTGGGG 0: 1
1: 0
2: 1
3: 22
4: 167
1178696379_1178696393 24 Left 1178696379 21:34796427-34796449 CCATCCAGCTGTAGCTCTTCTGT 0: 1
1: 0
2: 1
3: 23
4: 229
Right 1178696393 21:34796474-34796496 TGATTCAGCAGAAGTGTGGGGGG 0: 1
1: 0
2: 3
3: 29
4: 227
1178696379_1178696383 -6 Left 1178696379 21:34796427-34796449 CCATCCAGCTGTAGCTCTTCTGT 0: 1
1: 0
2: 1
3: 23
4: 229
Right 1178696383 21:34796444-34796466 TTCTGTCCTTTTGGCTGGCCTGG 0: 1
1: 0
2: 0
3: 13
4: 215
1178696379_1178696387 20 Left 1178696379 21:34796427-34796449 CCATCCAGCTGTAGCTCTTCTGT 0: 1
1: 0
2: 1
3: 23
4: 229
Right 1178696387 21:34796470-34796492 CCCCTGATTCAGCAGAAGTGTGG 0: 1
1: 1
2: 1
3: 15
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178696379 Original CRISPR ACAGAAGAGCTACAGCTGGA TGG (reversed) Intronic
900126695 1:1071940-1071962 ACAGAAGAGCATCAGCAGCAGGG + Exonic
901909041 1:12439455-12439477 GGAGAAGAGGTATAGCTGGAGGG - Intronic
902903761 1:19538962-19538984 AAAGAAGATATACAGATGGATGG - Intergenic
905091368 1:35433764-35433786 ACAGAACACATACAGATGGAGGG + Exonic
905415242 1:37799533-37799555 AAAGAAGAGCCTCAGCTGGATGG - Intronic
906029361 1:42705495-42705517 ACAGAAGAGGTACAGAAGGGTGG + Intergenic
907785068 1:57603424-57603446 ACAGAAGAGCTGTAGATAGAAGG - Intronic
908092396 1:60699989-60700011 AAAGACCAGCAACAGCTGGAAGG + Intergenic
908548367 1:65184925-65184947 AGAGAAGAGCCAAAGCTGGCAGG + Intronic
908809491 1:67965204-67965226 ACAGAAGAGCTACAAAGGGCTGG + Intergenic
911546869 1:99227803-99227825 ACAGAAGAGCAACTAATGGAAGG + Intergenic
911738024 1:101358798-101358820 AAAGAAGAAATACAACTGGATGG - Intergenic
912478138 1:109955521-109955543 AGGGAAGAGAGACAGCTGGATGG + Intergenic
915340833 1:155175839-155175861 ACATGAGAGTTACAGCTGGCTGG - Intronic
915668195 1:157463940-157463962 ACAGGAGAGCCAGAGATGGAGGG - Intergenic
916042122 1:160970470-160970492 AAAGAAGAGCTGGAGATGGAGGG - Intergenic
916723897 1:167505845-167505867 ACAAAAGAGCTGCAGGTGGCTGG - Intronic
918831255 1:189401205-189401227 AAAAAAGAGCAACAGTTGGATGG - Intergenic
921703747 1:218295997-218296019 ACAGATGATTTACAGCTGAATGG + Intronic
922025000 1:221741800-221741822 ACGGAGGAGCTACAGCAGGTAGG - Intronic
1064900062 10:20286550-20286572 ACAGAAGGTTTACAGCTGCATGG - Exonic
1066178696 10:32938836-32938858 ACAGAAGAGCTACAGGACCAGGG + Intronic
1067147612 10:43704503-43704525 CTTGAAGAGCTAAAGCTGGAAGG - Intergenic
1070929789 10:80252985-80253007 CCAGAAGACCTACAGCTGCAGGG - Intergenic
1071682647 10:87721966-87721988 ACACAATAGCTACATCTGGTTGG - Intronic
1072394619 10:95026168-95026190 ACAGGAGAGCTCCATCTGGCTGG - Intergenic
1073167953 10:101474484-101474506 AATGGAGAGCAACAGCTGGAGGG - Intronic
1074078629 10:110151093-110151115 ACAGAAGAGCCACAGATTGGGGG - Intergenic
1074682443 10:115921601-115921623 GAAGAAGAGCTACAGCTAAAAGG - Intronic
1075198351 10:120380226-120380248 AGGGAGGAGCTAAAGCTGGAGGG + Intergenic
1075508821 10:123052093-123052115 ACTGAAGGGTTAAAGCTGGAAGG - Intronic
1075562810 10:123480686-123480708 ACAGAACAGATGCTGCTGGAAGG + Intergenic
1076389576 10:130088709-130088731 ACAGAACAGGTAATGCTGGATGG + Intergenic
1078797479 11:14607294-14607316 AGAGGATAGCTACAGCTTGATGG - Intronic
1078998359 11:16727967-16727989 ACAGAAGATATACATCTGGGTGG + Intronic
1079139560 11:17799034-17799056 ACAGGAGAGCAACACCTGAAGGG - Intronic
1079289543 11:19174875-19174897 ACAGAGGAGCTAGAACTAGAGGG + Intronic
1080654480 11:34247980-34248002 AAAGAATAGCTACACCTGGTGGG + Intronic
1081689144 11:45064488-45064510 ACAAGAGAGATGCAGCTGGAGGG + Intergenic
1082611299 11:55301314-55301336 AGTGAAGAAATACAGCTGGAAGG - Intergenic
1082804584 11:57439637-57439659 ACAGCAGAGCATCAGCAGGAAGG + Intergenic
1084690086 11:70720062-70720084 CCAGAACAGCTCCTGCTGGAAGG + Intronic
1088469578 11:110178201-110178223 CCAGGAGAGCTGCAGGTGGAGGG - Intronic
1090716503 11:129436580-129436602 ACTCAAGACCTACAGCTGCAGGG - Intronic
1091541683 12:1468256-1468278 ACAGAAAAGCTGCAGGGGGAAGG + Intronic
1092277648 12:7074182-7074204 ACAGAAGACCTGCAGCTGCCAGG + Intergenic
1093102657 12:15046541-15046563 ACAGAAGACCTATATTTGGAAGG - Intergenic
1094064607 12:26349943-26349965 ATAAAAAAGCTACAGCTGGAAGG + Intronic
1095162490 12:38934261-38934283 AGATAGGAACTACAGCTGGAGGG + Intergenic
1096850510 12:54432682-54432704 ACAAGTGAGCAACAGCTGGATGG - Intergenic
1097274412 12:57802658-57802680 AAAGAAGAGCTACATCCTGAAGG - Intronic
1097388937 12:58985128-58985150 ACAGAAGGGATAGAGATGGAGGG + Intergenic
1101852395 12:108414394-108414416 AGAGAGAAGCTACAGCTGCATGG - Intergenic
1103280578 12:119754862-119754884 CCAGATGAGCTACAGCAGCAGGG + Intronic
1104088051 12:125493742-125493764 ACAGAAGAGAGGCAGCAGGAAGG + Intronic
1104286195 12:127426924-127426946 CCAGGAGAGCCAGAGCTGGAAGG - Intergenic
1106837888 13:33655787-33655809 ACAGGATAGCAACAGCTAGAAGG + Intergenic
1108712988 13:53052529-53052551 ACAGGTGACCTAGAGCTGGAAGG + Intergenic
1108715885 13:53077429-53077451 GAAGAAGTGCTGCAGCTGGAAGG + Intergenic
1109513576 13:63410872-63410894 ACAGGAGAGATACAGCTGTATGG - Intergenic
1113138243 13:107117554-107117576 ACAGAAGAGCGGCAGCTGGGAGG + Intergenic
1113362293 13:109642779-109642801 CCACAAGAGTTGCAGCTGGAAGG - Intergenic
1116387986 14:44356430-44356452 ACTGAAGAGCTACAGCCCGAGGG + Intergenic
1122361605 14:101170344-101170366 ACAGAACACCAGCAGCTGGAGGG - Intergenic
1122638858 14:103145308-103145330 AAAGAATAGCTACTCCTGGATGG - Intergenic
1122820709 14:104343405-104343427 ACAGAGGGCCTCCAGCTGGAGGG - Intergenic
1126775228 15:52094599-52094621 TCAGAACAGCTAGATCTGGATGG - Intergenic
1126795483 15:52257567-52257589 CCAGATGAGCTCCTGCTGGAAGG + Intronic
1132142287 15:99405875-99405897 ACAGGAGTGCTGCATCTGGATGG + Intergenic
1132567077 16:628498-628520 ACAGGAGAGCTGCAGCTGTGGGG - Exonic
1132813672 16:1815578-1815600 ACAGCAGAGCAACAGCTGGCGGG + Intronic
1133053443 16:3132184-3132206 ACAGAATAGCAACTGCAGGAAGG - Intronic
1133220684 16:4317954-4317976 GCCGAAGAGCCCCAGCTGGAGGG - Intronic
1133272423 16:4616707-4616729 ACAGAAGAGCAATAGCCGGGTGG + Intronic
1133422402 16:5657820-5657842 ACAGAAGAGCTTGAACTGGGAGG - Intergenic
1134556657 16:15171562-15171584 AAAGAAGATCCCCAGCTGGAAGG + Intergenic
1134562925 16:15226360-15226382 ACAGCAGAGCTACAGTGGGGTGG + Intergenic
1134917237 16:18083275-18083297 AAAGAAGATCCCCAGCTGGAAGG + Intergenic
1134923462 16:18137993-18138015 ACAGCAGAGCTACAGTGGGGTGG + Intergenic
1136909316 16:34133510-34133532 ACAGAAGAGTGAGAGGTGGAGGG - Intergenic
1138096382 16:54215158-54215180 CCAGCTGAGATACAGCTGGAGGG + Intergenic
1138744117 16:59343397-59343419 ACAGAAGAGCTCTATCTGTAGGG - Intergenic
1139834195 16:69825060-69825082 ACATAAAAGCTACAGATGCAAGG - Intronic
1139973371 16:70790345-70790367 AAAGAAAAGCCACAGGTGGAGGG + Intronic
1141068072 16:80930001-80930023 TCAGGAGAGCTGCAGCTGAATGG + Intergenic
1141687758 16:85580034-85580056 AGAGAAGGGATACAGCTGGGAGG + Intergenic
1141871757 16:86791339-86791361 ACAGAAGTGCTTAGGCTGGAAGG - Intergenic
1143114365 17:4573985-4574007 ACAGCAGAGCTGAAGTTGGAGGG - Intergenic
1143722466 17:8822535-8822557 AGCCAAGAGGTACAGCTGGAGGG - Intronic
1144031090 17:11324133-11324155 TGAGAAGAGCTGCAGATGGACGG - Intronic
1144144979 17:12388664-12388686 ACAGCAGAGTAACAGCTAGATGG + Intergenic
1144754903 17:17673589-17673611 ACAGAAGAGATGCAGATGGGGGG - Intergenic
1145836439 17:27957495-27957517 AGACAAGAGCAACTGCTGGAGGG + Intergenic
1146586836 17:34090072-34090094 ACAGATGAGTCACAGCTGGAAGG + Intronic
1147120320 17:38331639-38331661 AGGGAAGAGATACAGCTTGATGG - Intronic
1147745620 17:42692674-42692696 ACTGCAGACCTACATCTGGATGG + Exonic
1148220410 17:45857931-45857953 TCAGAAGTCCTGCAGCTGGATGG - Intergenic
1153032863 18:731441-731463 GCATTAGATCTACAGCTGGAGGG + Intronic
1153478216 18:5519608-5519630 ACTGCAGAGCTACATGTGGAGGG + Intronic
1154259147 18:12814480-12814502 ACATAACAGTTATAGCTGGAGGG - Intronic
1155069915 18:22305826-22305848 ATGGAAGAGCCACAGATGGAAGG + Intergenic
1155325689 18:24662733-24662755 AGAGCAGAGCTAGAGCTGCAGGG - Intergenic
1155435731 18:25810935-25810957 CCAGAGGAGCTAATGCTGGAGGG + Intergenic
1156041457 18:32827860-32827882 ACAGAAGCGGGACAGTTGGAAGG + Intergenic
1156949107 18:42871669-42871691 ACAGAACATCTACACCTGGTTGG - Intronic
1158797915 18:60871019-60871041 ACAGGAGAACCACAGATGGAAGG + Intergenic
1161028928 19:2049107-2049129 TCAGCAAAGCTACAGATGGACGG + Intronic
1163270167 19:16248320-16248342 ACAGGGAAGCTACAGATGGAGGG + Intergenic
1165448438 19:35869208-35869230 ACTGGAGAGCTACATCTGGTTGG - Intronic
928022874 2:27717143-27717165 TCAGGAGAGCAACAGCTGGCAGG - Intergenic
930527256 2:52545573-52545595 ACTTGAGAGCTACAGCTTGATGG + Intergenic
937667969 2:124508195-124508217 ACTCAAGAGATACAGCTAGAAGG + Intronic
938046799 2:128128610-128128632 ACAGAAGAGATAGAGATGAAGGG - Intronic
941869931 2:170373398-170373420 AAAGAGTTGCTACAGCTGGAGGG - Intronic
942349260 2:175035973-175035995 ACAATAGAGCTAAAGCTAGAGGG + Intergenic
943200254 2:184813868-184813890 AAAGAAGAGCTTCATCTTGATGG - Intronic
945040571 2:205740628-205740650 GCCGAAGAGCTCCAGCCGGAGGG - Exonic
945609010 2:211974571-211974593 ACAGTAGAGTTAAAACTGGAAGG - Intronic
945840836 2:214886223-214886245 ACATAAAAGGTACAGCTTGAGGG + Intergenic
947376951 2:229505575-229505597 ACAGGAGAGCTACAGATTCAAGG + Intronic
948159858 2:235814775-235814797 ACAGCAGAGCTGCGGATGGAGGG + Intronic
948368155 2:237472020-237472042 ACAGCAGAGCTAGGGCTGCAGGG + Intergenic
1170857216 20:20068343-20068365 CCAGAAGACCAAGAGCTGGAGGG + Intronic
1171771722 20:29327217-29327239 ACAGAAGAGCGAGAGTTGGAGGG + Intergenic
1171813676 20:29764426-29764448 ACAGAAGAGCGAGAGTTGGAGGG + Intergenic
1172460875 20:35117580-35117602 AGAGAAGACCTACATGTGGAAGG - Intronic
1173096151 20:40030491-40030513 ACAGAAGAGCTCCAGGTGTGAGG + Intergenic
1173688897 20:44943505-44943527 ACAGAAGCCCTCAAGCTGGATGG - Exonic
1175850713 20:62090756-62090778 ACAGAAAAGTTACAGTTGGCTGG - Intergenic
1177754258 21:25325707-25325729 ACAGAAGACACATAGCTGGAAGG + Intergenic
1178696379 21:34796427-34796449 ACAGAAGAGCTACAGCTGGATGG - Intronic
1179117546 21:38507747-38507769 AAAGAGGAGCCACAGCTGGCTGG - Intronic
1180237841 21:46475112-46475134 ACAGAAGATGTGCAGCTGAAAGG + Intronic
1180317117 22:11285049-11285071 ACAGAAGAGCGAGGGTTGGAGGG + Intergenic
1180338209 22:11598415-11598437 ACAGAAGAGTGAGAGGTGGAGGG - Intergenic
1180612469 22:17106880-17106902 ACAGAAGCGCAACAGCAGAAAGG - Intronic
1181095699 22:20503882-20503904 ACAGAGGAGTTACATCTGGCTGG + Intronic
1181784042 22:25213251-25213273 ACAAAAGAGTCAGAGCTGGAAGG - Intergenic
1183209185 22:36440030-36440052 AGACAGGGGCTACAGCTGGAAGG - Intergenic
1183674402 22:39291607-39291629 AGACAGGAGCTACAGCTGTAGGG + Intergenic
1184172466 22:42768094-42768116 ACATAAGAGGACCAGCTGGACGG + Intergenic
949323788 3:2841209-2841231 TCAAAAGAGTTACAGCTGGGTGG + Intronic
951017898 3:17749370-17749392 AGAGATGAGCAACAGCGGGAGGG + Intronic
951777660 3:26326788-26326810 ACCTAAGAGCAAGAGCTGGAAGG - Intergenic
953904771 3:46863082-46863104 TCAGAAGGGCTGCAGCAGGAGGG - Intronic
953926773 3:46986562-46986584 TCAGTAGAGCTGCAGCTGGCAGG + Intronic
953943489 3:47124308-47124330 CCTGAAGAGGTACAGCTGGAGGG + Exonic
954219087 3:49141760-49141782 ACTGAGGAGGTACAGGTGGAGGG - Intergenic
956054485 3:65284119-65284141 AGAGAAGAGCTAAAGCTGCCTGG - Intergenic
957411933 3:79852441-79852463 GCAGAAAAGCTAGAGATGGAGGG + Intergenic
961453044 3:127011130-127011152 CCAGAACAGCTGCAGCCGGAAGG - Intronic
961857246 3:129884841-129884863 ACAAATGAGCTACAGCAGGCAGG + Intronic
965272794 3:166639326-166639348 ACAGAAGAGCTACAGCCCTTTGG + Intergenic
966669769 3:182513945-182513967 AGTGAAGAGCTACAGCTGTATGG + Intergenic
966850342 3:184161006-184161028 ATAGAGGAGCCAGAGCTGGATGG + Intronic
967157408 3:186706079-186706101 ACACAAGGGCTACAACTGGCTGG - Intergenic
967714353 3:192745281-192745303 CCAGGAGAGGTAGAGCTGGAAGG - Intronic
969350529 4:6595768-6595790 ACAGATGAACTCCAGCTGCAGGG + Intronic
970158373 4:13164368-13164390 ACAGAAGACCCACAGATGGGTGG - Intergenic
972645989 4:40967810-40967832 CCAGAAGAGCTACACCTCCAAGG + Intronic
973945741 4:55953376-55953398 ATAGTAGTCCTACAGCTGGATGG + Intronic
974205364 4:58695672-58695694 ACAGAAGATTTTCAGCTTGATGG - Intergenic
975321670 4:73015474-73015496 AAGGAATAGCTACAGGTGGAGGG - Intergenic
977334007 4:95673077-95673099 TCAGAAGATCAACAGCTGCATGG + Intergenic
978718907 4:111881485-111881507 ACTGAATAGCTACAGCAAGATGG + Intergenic
980418671 4:132528471-132528493 ACAGTAGAGTGACACCTGGAGGG + Intergenic
980450298 4:132960333-132960355 ACAGAAGAGCTGCAGCTCTTTGG + Intergenic
980486399 4:133462456-133462478 ACATAAGAGCTGCAGCAGCATGG + Intergenic
983351751 4:166599026-166599048 ACTGAAGATCTACACCTAGAGGG + Intergenic
984554935 4:181202307-181202329 ACAGGGGAGTTACAGCTGGGTGG + Intergenic
985444849 4:190016111-190016133 ACAGAAGAGCGCGAGGTGGAAGG - Intergenic
985445305 4:190018397-190018419 ACAGAAGAGCGAGAGGTGGAGGG - Intergenic
985624352 5:977312-977334 TCACAAGAGCCCCAGCTGGAGGG - Intergenic
987161481 5:15148765-15148787 ATAGGAGAGCTCCACCTGGAAGG + Intergenic
989537673 5:42582668-42582690 ACAGAAGAGCTACAGCCCTTTGG + Intronic
989644567 5:43616117-43616139 ACAGAAGAGCTACAGTGTGAAGG - Intronic
994526668 5:100914562-100914584 AAATAAGATCTACCGCTGGAAGG + Intergenic
996962812 5:129271503-129271525 ACAGCAGAGCAACCACTGGAGGG - Intergenic
999067981 5:148712403-148712425 AAAAAACAGATACAGCTGGATGG - Intergenic
999219132 5:149960609-149960631 ACAGAAGAGCACAAGCTGGAAGG - Intergenic
999658517 5:153834095-153834117 ACAAAGGTGCTTCAGCTGGAAGG + Intergenic
1000019210 5:157304151-157304173 GCAGAAGCCCTACAGCTGGCCGG - Intronic
1000953437 5:167513724-167513746 ACAGGAAAGCTTCTGCTGGATGG - Intronic
1001435178 5:171694459-171694481 AAAAAAGACCTTCAGCTGGAGGG - Intergenic
1001499080 5:172214596-172214618 CATGAAGAGTTACAGCTGGATGG + Intronic
1001499643 5:172220337-172220359 ACAAAAAAGCTATAGCTGGCCGG + Intronic
1001725323 5:173892028-173892050 ACACATGTGCTACAGCTAGAGGG + Intronic
1005267780 6:24130847-24130869 CCTGAAAAGCTACAACTGGAAGG + Intronic
1007420521 6:41716488-41716510 TCACAGGAGCTAGAGCTGGAAGG + Intronic
1008527217 6:52419331-52419353 ACTGAAGAGCTGCAGGTTGAAGG - Intergenic
1008600324 6:53087393-53087415 ACAGCAGAGCTAGAACTGGAGGG + Intronic
1008716506 6:54295682-54295704 ACTGAAGAGCTCCAGCCGAATGG - Intergenic
1010935994 6:81862141-81862163 AAAGAAGAGTTGCAGATGGAGGG - Intergenic
1011390514 6:86847437-86847459 ACCCAAGTGGTACAGCTGGAGGG + Intergenic
1011660766 6:89592149-89592171 CCAGAAGGGCTATGGCTGGAGGG - Intronic
1012482952 6:99688835-99688857 ACAGAAGAGCTGGAGCAAGATGG + Intergenic
1013986316 6:116198431-116198453 ACATAAGAACTACAGGTGGCTGG + Intronic
1014930281 6:127327306-127327328 ACAGAAGAGGTACACATGGCAGG + Intronic
1015286540 6:131491632-131491654 ACAGAATAGCTACAGATAGATGG - Intergenic
1016508580 6:144813788-144813810 AGAGCAGAGCTAAACCTGGAAGG + Intronic
1016532142 6:145070756-145070778 ACAGAATAGCTGCATCTGGATGG + Intergenic
1016717596 6:147251832-147251854 ACAGGAGAGCTTCGGCTGGTGGG + Intronic
1022712938 7:32869373-32869395 ACAGAAGAGTTTGAACTGGATGG - Exonic
1022943783 7:35262255-35262277 CCAGAAAAGCTGCAGCTGGCCGG - Intergenic
1023583802 7:41708157-41708179 ACAGGAGAGCAACACCTGGAAGG - Intergenic
1023820610 7:43978618-43978640 ACAGGAGAGCAATGGCTGGAGGG - Intergenic
1027830664 7:83173171-83173193 AGAGATGGGCTATAGCTGGAGGG - Intergenic
1029748888 7:102532061-102532083 ACAGGAGAGCAATGGCTGGAGGG - Intergenic
1029766831 7:102631167-102631189 ACAGGAGAGCAATGGCTGGAGGG - Intronic
1030001698 7:105071329-105071351 ACAGCACAGCTCCTGCTGGAAGG - Intronic
1031319630 7:120307952-120307974 ACAGAAGAACTAAAGCTTGTGGG + Intronic
1031615635 7:123876061-123876083 TCAGAAGAGCTTCATCAGGAAGG + Intronic
1032071700 7:128811730-128811752 CCAGGAGAGGTGCAGCTGGAAGG + Intronic
1032693771 7:134316256-134316278 AAAAAAGAGCTAGAGTTGGATGG + Intronic
1032781517 7:135168365-135168387 ACAGATGAGCAGCAGCTGCAGGG - Intronic
1033265876 7:139886602-139886624 ACAACAGAGCTACTGCAGGAAGG + Intronic
1034146390 7:148876694-148876716 ACCAAAGAGGTACAGCTGGATGG + Intronic
1034215020 7:149398584-149398606 ACAGCAAAGCAGCAGCTGGAGGG - Intergenic
1035983611 8:4401525-4401547 ACAGGGGAGCTACTGCTGGGAGG - Intronic
1036255860 8:7206275-7206297 ACAGAAGGACAACAGATGGATGG + Intergenic
1036361625 8:8081224-8081246 ACAGAAGGACAACAGATGGATGG - Intergenic
1036481086 8:9140299-9140321 ACAGCAGAGATACACGTGGACGG + Exonic
1036889346 8:12585802-12585824 ACAGAAGGACAACAGATGGATGG + Intergenic
1040023254 8:42759430-42759452 AAAGAAGAGCGACAGCAGGTAGG + Intronic
1042608907 8:70576823-70576845 ACCGAAGAACTACAGCTGGGTGG - Intronic
1043393947 8:79818327-79818349 ACAGGAGAGCCAGACCTGGAAGG - Intergenic
1046651144 8:116837803-116837825 AGAGAAAAGTCACAGCTGGAGGG + Intronic
1047799360 8:128292866-128292888 ACAGCAGAGCCACAGATGTAAGG + Intergenic
1049377158 8:142294740-142294762 ACAGAGGAGCTGCTGCTGCAGGG + Intronic
1049929901 9:446236-446258 GCAGAAAAGCTACAGATGCAGGG - Intronic
1050236945 9:3591947-3591969 ATAGAAGAGGTACAGTTGGCCGG + Intergenic
1051149195 9:14062154-14062176 ACAAAAAAGCAGCAGCTGGATGG + Intergenic
1052405539 9:28055318-28055340 ATAGAACAGGTACAGGTGGATGG + Intronic
1052696221 9:31882470-31882492 ACAGAAAAGCTTCAGCATGACGG + Intergenic
1054143791 9:61548268-61548290 ACAAAAGAGACAGAGCTGGAGGG + Intergenic
1054851586 9:69852188-69852210 GCAGAAAAGCTACAGTTGGTAGG + Intronic
1060409215 9:123389102-123389124 ACATGAGAACCACAGCTGGAGGG + Intronic
1060814471 9:126627378-126627400 GCAGAAGGGCTCCAGCTGGCAGG - Intronic
1061196794 9:129110983-129111005 ACAGGGGAGAGACAGCTGGACGG - Intronic
1061279096 9:129586831-129586853 CCAGAAGAGCTACAGCTGGCAGG + Intergenic
1061834321 9:133318633-133318655 ACTGAAGAACCTCAGCTGGAGGG + Intergenic
1203365356 Un_KI270442v1:250761-250783 ACAGAAGAGCGAGGGTTGGAGGG + Intergenic
1185832427 X:3314952-3314974 ACATAAGAGATAAAGATGGATGG + Intronic
1186676920 X:11827765-11827787 CCAAAAGAGCTACAGATGCATGG + Intergenic
1189632281 X:42967624-42967646 TGAGAAGAGACACAGCTGGAAGG + Intergenic
1189737008 X:44081461-44081483 ACAGAAGATGTACAGCTTGAGGG + Intergenic
1190275455 X:48896535-48896557 ACAGAGGAGCTCCAGTTGGGTGG + Intronic
1192871967 X:75193349-75193371 ACAGAAAAGCTACAAAGGGAAGG - Intergenic
1194603677 X:95955895-95955917 ACAGTAGAGCTTCAGCGGTAAGG + Intergenic
1196367737 X:114942611-114942633 AGAGGAGAGCTCCAGCTGGTGGG - Intergenic
1200324288 X:155221586-155221608 ACAGTAGAGGTACAGGGGGATGG + Intronic
1201065171 Y:10089824-10089846 ACAGAAGAGCGAGAGGTGGAGGG + Intergenic
1201065583 Y:10091966-10091988 ACAGTAGAGCGCCAGGTGGAGGG + Intergenic
1201357312 Y:13111646-13111668 ACAGGGGAGCTTCATCTGGATGG + Intergenic