ID: 1178700307

View in Genome Browser
Species Human (GRCh38)
Location 21:34827733-34827755
Sequence ACCTAGGCTGCCATTCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178700300_1178700307 8 Left 1178700300 21:34827702-34827724 CCCCAGCTGTGGCTTCAGTGGGC 0: 1
1: 0
2: 16
3: 77
4: 446
Right 1178700307 21:34827733-34827755 ACCTAGGCTGCCATTCTGAAGGG 0: 1
1: 0
2: 2
3: 9
4: 139
1178700302_1178700307 6 Left 1178700302 21:34827704-34827726 CCAGCTGTGGCTTCAGTGGGCCT 0: 1
1: 0
2: 5
3: 51
4: 336
Right 1178700307 21:34827733-34827755 ACCTAGGCTGCCATTCTGAAGGG 0: 1
1: 0
2: 2
3: 9
4: 139
1178700296_1178700307 17 Left 1178700296 21:34827693-34827715 CCTTGGCCACCCCAGCTGTGGCT 0: 4
1: 7
2: 42
3: 106
4: 506
Right 1178700307 21:34827733-34827755 ACCTAGGCTGCCATTCTGAAGGG 0: 1
1: 0
2: 2
3: 9
4: 139
1178700301_1178700307 7 Left 1178700301 21:34827703-34827725 CCCAGCTGTGGCTTCAGTGGGCC 0: 1
1: 0
2: 15
3: 73
4: 393
Right 1178700307 21:34827733-34827755 ACCTAGGCTGCCATTCTGAAGGG 0: 1
1: 0
2: 2
3: 9
4: 139
1178700297_1178700307 11 Left 1178700297 21:34827699-34827721 CCACCCCAGCTGTGGCTTCAGTG 0: 1
1: 1
2: 11
3: 64
4: 403
Right 1178700307 21:34827733-34827755 ACCTAGGCTGCCATTCTGAAGGG 0: 1
1: 0
2: 2
3: 9
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178700307 Original CRISPR ACCTAGGCTGCCATTCTGAA GGG Intronic
900605728 1:3522781-3522803 ACCTGGGCTGCCCTTCTACAAGG + Intronic
908701797 1:66910296-66910318 ACTTAGGCTTTTATTCTGAATGG - Intronic
909210461 1:72816497-72816519 ACCTGGACTGCCAGTGTGAAAGG + Intergenic
918128254 1:181603315-181603337 ACCAAGGCTGCCTGTCTGCAGGG + Intronic
919183973 1:194120420-194120442 GCTTAGGCTGCCCTTCTCAAAGG + Intergenic
919656237 1:200200185-200200207 ACCTATGCTGTGATTCAGAAAGG - Intergenic
923267505 1:232328801-232328823 TCCTAGGATGCCATTTTTAAAGG + Intergenic
923769316 1:236924131-236924153 AGCTAGGGTGACATTCTGATTGG - Intergenic
923881710 1:238110929-238110951 ACTTGGGCTGACACTCTGAATGG + Intergenic
1063536742 10:6891144-6891166 GCCCAGGCTGGTATTCTGAAAGG + Intergenic
1063601521 10:7485559-7485581 TTCTAGCCTTCCATTCTGAAGGG + Intergenic
1070498950 10:77052405-77052427 ACCCAGCCTGGCTTTCTGAAAGG + Intronic
1071157873 10:82712118-82712140 ACTTTGGTTGCCATTTTGAATGG + Intronic
1074117029 10:110464074-110464096 GCCTATGCTGACATTGTGAAGGG - Intergenic
1075060161 10:119251528-119251550 GCCCAGGCTTCCATTCTGACAGG + Intronic
1079338197 11:19589702-19589724 TTCTAGGCCCCCATTCTGAAAGG - Intronic
1080161190 11:29179052-29179074 ATATAGGCTGCCATGCTCAAAGG + Intergenic
1080425526 11:32150638-32150660 TCCAAGGCTACCATTATGAAGGG + Intergenic
1083908513 11:65690563-65690585 ACCCAGGCTGCCATTGTGAAAGG + Intergenic
1086399000 11:86445692-86445714 ATATAGGCTGTCATTCTTAATGG + Intronic
1086492300 11:87367726-87367748 AGCTAGTCTGCCATTTTCAATGG + Intergenic
1087365044 11:97208220-97208242 ACCTTGACTGCCATTTTGAGAGG - Intergenic
1089543397 11:119205005-119205027 ACCCAGGATGCCTGTCTGAATGG + Intergenic
1089845480 11:121454756-121454778 ACCTGTGCTTGCATTCTGAAGGG - Intronic
1092393545 12:8103831-8103853 ACCTATCCTTCCAATCTGAAAGG + Intergenic
1099652177 12:85442496-85442518 ACCGAGGCTGCCAGGCTGGAGGG - Intergenic
1101249521 12:102918048-102918070 AGCTATGCTGCCATTCTGGTGGG + Intronic
1106471200 13:30056075-30056097 ACCTAGGCCACCAGTGTGAAAGG - Intergenic
1112330663 13:98474849-98474871 ACCTCGGGTGCCATCCAGAATGG + Exonic
1118769298 14:68931127-68931149 ACCAAGGCTGAGATTCTCAATGG + Intronic
1120243454 14:81977361-81977383 ACCTAGTGTGACAATCTGAAGGG + Intergenic
1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG + Intronic
1126568728 15:50127401-50127423 ACTTGGGCTTCCATTCTAAATGG + Intronic
1126702463 15:51380517-51380539 AGCCAGGCTGGCATTCTGAGAGG + Intronic
1126729831 15:51671507-51671529 TCCTTGGCTGCCTTTCTGATGGG + Intergenic
1128772385 15:70292009-70292031 ATCTAGCCTGCCATTCCAAATGG + Intergenic
1130634910 15:85608873-85608895 ACTTAGGCTGTCATTCAGAAAGG - Intronic
1133726650 16:8543625-8543647 ACCTTGGCTGTCATTGAGAAAGG - Intergenic
1143630877 17:8139752-8139774 ACCTAGACTGACCTGCTGAAGGG + Intergenic
1146176459 17:30668674-30668696 ACCACGGCTGCCATGCTGAGAGG + Intergenic
1146257505 17:31400138-31400160 ACCTGGGCTCGCATTCTGATAGG + Intronic
1146349919 17:32084788-32084810 ACCACGGCTGCCATGCTGAGAGG + Intergenic
1147325889 17:39669432-39669454 ACATGGGCTGCCCTTCGGAAGGG - Intronic
1149067587 17:52498460-52498482 ACCTATGCTGTTTTTCTGAATGG + Intergenic
1150593935 17:66586989-66587011 TCCTACGATGCCATTATGAATGG + Intronic
1155994725 18:32318714-32318736 AAGTAGACTGCCATGCTGAAGGG - Intronic
1156709066 18:39919776-39919798 AACAAGGCTGTCATTCTGAAAGG - Intergenic
1162982367 19:14248223-14248245 ACCACGGCTGCCATGCTGAGAGG - Intergenic
1164190191 19:22908432-22908454 AATTAGTCTGCTATTCTGAAAGG - Intergenic
1165972248 19:39641624-39641646 ACATAGGCTATCATTTTGAACGG - Intergenic
1166700521 19:44879220-44879242 ACAGAGGCTGCCTTTCTGGATGG + Intronic
927042199 2:19240884-19240906 TCCAAGGGTGCCATTCTGAGAGG - Intergenic
929068083 2:38000278-38000300 GCCTGGGCTGCCATTTTGTAAGG - Intronic
930498238 2:52176079-52176101 ACCCAGGCCGCCACTGTGAAAGG - Intergenic
932467044 2:71930549-71930571 ACCGAGTCTCCCATGCTGAAAGG - Intergenic
934115881 2:88793026-88793048 ACCAAAGGTGCCATTCTGCAAGG - Intergenic
934627713 2:95875885-95875907 ACCAAAGGTGCCATTCTGCAAGG + Intronic
934805852 2:97225411-97225433 ACCAAAGGTGCCATTCTGCAAGG - Intronic
934920901 2:98344541-98344563 TCCTAGGCTGCCATGATGGAGGG - Intronic
937438316 2:121897111-121897133 GCCTGGGCTGCCATTCTAACAGG + Intergenic
942513128 2:176723765-176723787 AACCACTCTGCCATTCTGAATGG - Intergenic
943157535 2:184202765-184202787 ACCTAAGATGCCATTGTGCAAGG - Intergenic
944069752 2:195655929-195655951 ACCTAGCCGTCCATACTGAATGG + Intronic
944840668 2:203620908-203620930 CCCATGCCTGCCATTCTGAAGGG - Intergenic
947377696 2:229513616-229513638 CCCTAGGCTGTCATTAAGAAGGG - Intronic
1170769403 20:19318871-19318893 ACCGAGGCAGCCATTCAGCATGG - Intronic
1170827943 20:19812681-19812703 CCCAAGTATGCCATTCTGAATGG - Intergenic
1171244747 20:23602337-23602359 AAATAGGCTGCCCTTCTGAGAGG + Intergenic
1175105238 20:56610336-56610358 ACCTGGGTGGCCAGTCTGAAAGG + Intergenic
1175436623 20:58956357-58956379 ACCTAGGCTGCAAACCTGTAGGG + Intergenic
1178700307 21:34827733-34827755 ACCTAGGCTGCCATTCTGAAGGG + Intronic
1179164027 21:38921129-38921151 ACCAGGGCTGCTATTTTGAAGGG + Intergenic
1179547549 21:42122893-42122915 ACCAAGGCTGCCTTTGTGCAAGG + Exonic
1183343942 22:37296555-37296577 AGCTGGGCTTCCATCCTGAAAGG + Intronic
1184258030 22:43298060-43298082 GCCTAAGCCGCCCTTCTGAAAGG - Intronic
950361720 3:12454135-12454157 ATTTAGGCTGCTATCCTGAAAGG + Intergenic
951580638 3:24159141-24159163 ACCTTGAATCCCATTCTGAATGG - Intronic
952801570 3:37297559-37297581 AACTACTGTGCCATTCTGAATGG + Intronic
954277258 3:49550690-49550712 ACGGAGGCTGCCATGCTGAAAGG + Intergenic
954570424 3:51636548-51636570 TCCTAGGCTGGCACTCTGTAAGG + Intronic
956265444 3:67391587-67391609 ACCGAGGCTGCCTTTTTGATAGG - Intronic
956716634 3:72085557-72085579 ACCTGGGCTGCGACTCAGAATGG - Intergenic
956717042 3:72087992-72088014 ACCTGGGCTGCGACTCAGAATGG - Intergenic
957344199 3:78941429-78941451 ACCTTGGCTGGAATTCTGAAAGG + Intronic
959286893 3:104426192-104426214 ACCAATGCTGCTAATCTGAAAGG + Intergenic
961998393 3:131270032-131270054 ACCTAGGATCCCATTGGGAATGG - Intronic
962318305 3:134372297-134372319 ACCTTGGCAGTCATTCTGCAAGG + Intronic
963068008 3:141279200-141279222 GCCCTGGCTGCCATTCTGGATGG - Intronic
964970293 3:162552060-162552082 ACCTGGGCTGCCATGGTCAAAGG + Intergenic
965624022 3:170669014-170669036 TCCAAGGCTGCCATGCTGTAGGG - Intronic
966483362 3:180438272-180438294 ACCTAGGCTACTATTCAGCAAGG + Intergenic
966875866 3:184321343-184321365 ACGAAGGCTGGGATTCTGAAGGG - Exonic
968048801 3:195639549-195639571 GCCAAGGCTGGCATCCTGAAGGG - Intergenic
968098600 3:195950078-195950100 GCCAAGGCTGGCATCCTGAAGGG + Intergenic
968305816 3:197650375-197650397 GCCAAGGCTGGCATCCTGAAGGG + Intergenic
968830424 4:2930787-2930809 ACCTAGGCTCCCACTCTGCCTGG + Exonic
973017184 4:45155176-45155198 AACTCAGCTGCCTTTCTGAAAGG + Intergenic
975333135 4:73142536-73142558 ACTTAGAATGCCATTATGAATGG + Intronic
975814695 4:78205693-78205715 ACCTAAGCTTCCTTTCTGAGAGG + Intronic
981998520 4:151001261-151001283 ACCTAGGCTGCCACCATTAAAGG + Intronic
983534195 4:168839742-168839764 ACCTAGGCTGCCATTCTGGGAGG + Intronic
985505281 5:276028-276050 GCCAAGGCTGGCATCCTGAAGGG - Intronic
985742846 5:1629592-1629614 GCCAAGGCTGGCATCCTGAAGGG + Intergenic
988309999 5:29544207-29544229 AGCAAGGCTGCCATTGTGACAGG - Intergenic
988568499 5:32341143-32341165 ACCTGGGCTGTCACTATGAAAGG + Intergenic
989691939 5:44154811-44154833 ACCCTGGCTGCCATTGTAAATGG - Intergenic
991620483 5:68539877-68539899 ACATGGGTTACCATTCTGAAAGG + Intergenic
994314523 5:98316853-98316875 ACCTAGACTGCCACTTTGGAAGG - Intergenic
996518151 5:124396443-124396465 ACCTAGGCTACATTTCTCAATGG + Intergenic
998377480 5:141700803-141700825 ATCTAGGCTGCACGTCTGAAAGG + Intergenic
998421786 5:141994214-141994236 ACTTTGGCTGCCACTCTGAGAGG + Intronic
1000475072 5:161696906-161696928 ACCAGGGCTGCCTTACTGAAGGG - Intronic
1006364016 6:33604253-33604275 GCTTGGGCTGCCATTCTGGAGGG - Intergenic
1007073471 6:39052576-39052598 ACACTGGCTGCCAATCTGAAAGG - Intronic
1013724544 6:113077475-113077497 ACATAGGAGGCCATCCTGAATGG + Intergenic
1018055291 6:160047086-160047108 TCCAAGGCTGCCACACTGAAGGG - Intronic
1018997985 6:168724772-168724794 ACCTGGGCAGCCATCCTGAAGGG + Intergenic
1019450273 7:1094096-1094118 ACCTAAGCTGCCTTTCTAGAAGG + Intronic
1020251566 7:6472939-6472961 ACCCAGGCTGCCAGGCTGGAGGG + Intronic
1020363377 7:7353809-7353831 ATCTAGGCTGCTATTTTGACGGG - Intergenic
1021197505 7:17689404-17689426 ACCTAAGTTCCCATTCTGTAAGG - Intergenic
1024528623 7:50371786-50371808 GCCTATGCTGCCCTTTTGAAAGG + Intronic
1024739071 7:52336011-52336033 ACCTAGGCTGCATTGCTGCAAGG - Intergenic
1027802019 7:82766182-82766204 GCCAAGGCTGCCACTCTCAAAGG - Intronic
1028318707 7:89435393-89435415 ACCATGGCTGCCAATCTCAAAGG + Intergenic
1028723133 7:94057076-94057098 ACCTCAGCTGCCATTTTAAAAGG - Intergenic
1030474141 7:110006916-110006938 ACCTAGGAAGCCATGTTGAATGG - Intergenic
1031160424 7:118161044-118161066 ACTCAGGCTGCCATGGTGAAAGG + Intergenic
1032990351 7:137387980-137388002 GCCAAAGCAGCCATTCTGAAAGG + Intronic
1037084228 8:14827126-14827148 AACTTAGCTGCCATGCTGAAAGG - Intronic
1039646414 8:39289545-39289567 AACTAGTCTGTGATTCTGAAAGG + Intergenic
1040603226 8:48904639-48904661 ATCAAGGCTGCCAGCCTGAAGGG + Intergenic
1044032848 8:87260057-87260079 ACCTCGACTGCCACTGTGAAAGG + Intronic
1044336135 8:90985827-90985849 ACACAGACTGCCATCCTGAAAGG + Intergenic
1052974849 9:34402755-34402777 ACCCATGCTGCCATTCTTCAGGG + Exonic
1058485377 9:105438972-105438994 ACCTACACTGCCATTATGAGAGG - Intronic
1061652207 9:132059801-132059823 ACCTAAGCTGCCATTCAGACTGG - Intronic
1186304995 X:8246870-8246892 AACTGGACTGCCATTCTGGAGGG - Intergenic
1189846706 X:45145240-45145262 ACCTAAGTTGCCTTTTTGAAGGG + Intergenic
1190136342 X:47802727-47802749 ACCCAGGCTGCCAGTGTGAAAGG + Intergenic
1190540999 X:51478889-51478911 ACCTAGGCTGTCACTGTGAAAGG + Intergenic
1192012477 X:67289687-67289709 ACCTAGGTGATCATTCTGAATGG + Intergenic
1192086750 X:68106312-68106334 GCCTGGGCTACCATTCTGAAGGG - Intronic
1194482373 X:94442071-94442093 AGCCTGGCTGCCATTCTTAAAGG - Intergenic
1194603574 X:95954519-95954541 ATCTAGGCTGCTTTTCTAAATGG + Intergenic
1194856230 X:98932791-98932813 AGCTTGGGTGCCATTCTGGAGGG + Intergenic
1196943200 X:120797997-120798019 ACCTAAGCTGCCAGGATGAAGGG + Intergenic
1199121175 X:144055828-144055850 ACCTAGGTGCCCATTCTGAGAGG + Intergenic
1199818703 X:151423343-151423365 ACCTAGGATTCAATTCTGACTGG - Intergenic
1199986641 X:152957407-152957429 ACCCAGACTGCCACTGTGAAAGG + Intronic
1201733291 Y:17229358-17229380 AACTCAGCTGCCATTCTGTAAGG + Intergenic