ID: 1178701713

View in Genome Browser
Species Human (GRCh38)
Location 21:34839454-34839476
Sequence CTGTGAACTCAAAGCGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178701710_1178701713 28 Left 1178701710 21:34839403-34839425 CCGACACACACACTCGGGATGTA 0: 2
1: 1
2: 0
3: 12
4: 118
Right 1178701713 21:34839454-34839476 CTGTGAACTCAAAGCGAACAGGG 0: 1
1: 0
2: 1
3: 9
4: 116
1178701711_1178701713 -6 Left 1178701711 21:34839437-34839459 CCTAGAAATACACATTTCTGTGA 0: 1
1: 0
2: 4
3: 34
4: 376
Right 1178701713 21:34839454-34839476 CTGTGAACTCAAAGCGAACAGGG 0: 1
1: 0
2: 1
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178701713 Original CRISPR CTGTGAACTCAAAGCGAACA GGG Intronic
902798080 1:18812368-18812390 CTTTGAACTCAAGGCGATCTTGG + Intergenic
903030553 1:20461114-20461136 CTGTGAACTCAGTGAGGACAGGG - Intergenic
903179171 1:21596945-21596967 CTCTGGACTCAGAGGGAACAAGG - Intronic
910750401 1:90622964-90622986 CTGTGGGCTCAAAGAGAGCAAGG - Intergenic
911063565 1:93768385-93768407 CTTTGAACTCAAACCCATCAGGG - Intronic
911209845 1:95127502-95127524 CTGTGAACTCAAGGAAAACCTGG - Intronic
913494375 1:119414863-119414885 CTGTGAACTTAAACCAAACTGGG - Intergenic
915804607 1:158831409-158831431 CTGAGAAATGAAAGCTAACAAGG - Exonic
920220888 1:204399651-204399673 CTGTAAACTCCATGAGAACAGGG - Intergenic
920862825 1:209724445-209724467 CTGTGCACTTACAGGGAACATGG - Intronic
923079690 1:230641953-230641975 CTGGGAACTCATAGGGAAGAAGG - Intergenic
1064706332 10:18076172-18076194 CTGTGAACTCAGAGGGGAGACGG - Intergenic
1064973197 10:21087144-21087166 CTGTGAACTCCTGGAGAACAGGG + Intronic
1065720377 10:28623329-28623351 TTGGGAACTCAAAGAGATCAGGG - Intergenic
1069037369 10:63659446-63659468 CTGTGAACTCCTTGAGAACAAGG + Intergenic
1070789120 10:79179269-79179291 CTGTGGACTCCTAGAGAACAGGG + Intronic
1072736851 10:97885015-97885037 CTGGGAACTCCATGAGAACAGGG - Intronic
1075266122 10:121000771-121000793 GTGGGAACTGAAAGCTAACAAGG - Intergenic
1081345305 11:41978485-41978507 CTGTGGCCTCAAAGCCAGCAAGG + Intergenic
1082967922 11:58987119-58987141 CTTTGAAATCAATGAGAACAAGG - Intronic
1083386726 11:62316575-62316597 CTGTGAACTCCAGGAGGACAGGG - Intergenic
1087164456 11:94987166-94987188 CTGTGAATGCAAATGGAACAAGG + Intronic
1095428707 12:42109066-42109088 ATATGAACTCAAAGGGAAAATGG - Intronic
1095510852 12:42950144-42950166 CTGTGAACTCCATAGGAACAAGG + Intergenic
1097277870 12:57825451-57825473 CTGTGAACTCCTGGCTAACAAGG - Intronic
1098799299 12:74933820-74933842 CTGTGAAGTCAAAGTGAAAATGG - Intergenic
1099531075 12:83781966-83781988 CTGTCAACACAAAGAAAACAAGG + Intergenic
1102796299 12:115691745-115691767 CTGCTATCTCAAAGCGAAAAGGG + Intergenic
1102823304 12:115926367-115926389 CTGTGAGCACCAAGCGGACAAGG + Intergenic
1103620743 12:122185758-122185780 CTGTGACCTCAAAGACATCAGGG - Intronic
1104781602 12:131424232-131424254 CTGAGAACTCAAAGCTGAGAAGG + Intergenic
1107000706 13:35541313-35541335 CTGTGAACTCCTAGAGATCAGGG + Intronic
1107001533 13:35551741-35551763 TTGTGAATACAAAGCCAACAGGG - Intronic
1107115162 13:36739257-36739279 GTGTGAATTCAAAGCGATAACGG + Intergenic
1108407485 13:50119867-50119889 CTGTGAGCTCATAGCTACCACGG - Intronic
1109758507 13:66794821-66794843 CAGTGAACTGAAAGTGAAAAGGG - Intronic
1112204589 13:97311714-97311736 CCATGACCTCAAAGCAAACAAGG - Intronic
1113116594 13:106880432-106880454 CTGTTAACTTAAAGAGAAAATGG + Intergenic
1114721399 14:24886151-24886173 TTGTGAACTCAAAGCGATTGGGG - Intronic
1116283780 14:42945835-42945857 CTGTGAACTAGAAGACAACAGGG + Intergenic
1117831965 14:59760711-59760733 CTGTGAGCTCATAGGAAACATGG + Intronic
1118385651 14:65253595-65253617 CTGTGAACTCACAGTGAGCAAGG + Intergenic
1118619043 14:67597935-67597957 CTGTGAACTCAAAAACAAGAAGG + Intronic
1120183836 14:81371973-81371995 CAGTCAACTCAAAGCAAGCAGGG - Intronic
1120228056 14:81812658-81812680 CTGTGAACTCAAAATGGAGAGGG - Intergenic
1121371816 14:93365493-93365515 CTGAGAACTCAGAGTTAACATGG + Intronic
1128128742 15:65211589-65211611 CTGTGAACTGCAAGGGGACATGG - Intergenic
1135786168 16:25351176-25351198 CTGAGGACTCAAAGAGAAAAAGG - Intergenic
1138747808 16:59383849-59383871 CTGTGAAGTCAATAAGAACATGG + Intergenic
1140656649 16:77148015-77148037 CTGTGGACACAATGAGAACAAGG + Intergenic
1143445766 17:7008255-7008277 ATGAGAACTGAAAGAGAACAGGG - Intronic
1144798307 17:17907532-17907554 CTGTGAAATCAGAGAGAAAATGG + Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1150793515 17:68219604-68219626 CTGGGAAGTCAAAGCGAAAGTGG - Intergenic
1151737812 17:75955948-75955970 CTGTAATATCAAAGAGAACAAGG + Intronic
1152435040 17:80271350-80271372 CTGAGTACTCAAAGGGAAAAAGG + Intronic
1156104886 18:33648024-33648046 CTGTGAGGCCAAAGTGAACAAGG + Intronic
1156513070 18:37657745-37657767 CTGAAAACTCACAGAGAACAGGG - Intergenic
1162061019 19:8095396-8095418 CTGTGAGCTCAAAGCCATCCTGG + Exonic
1164962993 19:32452330-32452352 CTGTGAGGTCAAAGAGGACAAGG + Intronic
925855631 2:8126494-8126516 CTGTGACCTCCAAGGGAGCAGGG + Intergenic
925867941 2:8245282-8245304 CTCTGAACTCCAATAGAACATGG - Intergenic
929057316 2:37889490-37889512 CTGTGAACCCACAGAGACCATGG + Intergenic
930182552 2:48377686-48377708 TTGTGCACTGAAAGCTAACAGGG + Exonic
933817059 2:86076783-86076805 CTATGAAGTCAAGGCCAACAAGG + Intronic
940812351 2:158259335-158259357 CTGTGATCTCCATGAGAACAGGG + Intronic
942996202 2:182263570-182263592 CTGTGAATTCAGAGCTAAGAGGG - Intronic
943716625 2:191159784-191159806 CTGTGAACTCAAAGCCCTCCTGG + Intergenic
944139056 2:196434967-196434989 CTGTGAACTCAATGGGAGGATGG - Intronic
946633873 2:221702783-221702805 CAGAGAACTCAGAGCAAACAAGG - Intergenic
1173697443 20:45031091-45031113 CTGTAAACTCCATGAGAACATGG - Intronic
1176427015 21:6554230-6554252 CTGTGAAACCAGAGCGAAAACGG - Intergenic
1178701713 21:34839454-34839476 CTGTGAACTCAAAGCGAACAGGG + Intronic
1178972515 21:37193750-37193772 CTGTGCCCTCAAAGTGCACATGG + Intronic
1179702506 21:43162552-43162574 CTGTGAAACCAGAGCGAAAACGG - Intergenic
1181275452 22:21685059-21685081 CTGTGCACTCAGAGCCATCAGGG - Intronic
1183131345 22:35839749-35839771 CTGAGAAACCAAAGTGAACAAGG + Intronic
1184119975 22:42443868-42443890 CTGTGAACTAGAAGAGAGCATGG + Intergenic
1184192801 22:42906136-42906158 CTGTGAGCTCCAAGAGGACAAGG + Intronic
954391837 3:50271643-50271665 CTGTGAACTCAAAGAGGTCACGG - Intronic
956488167 3:69742989-69743011 CTGCAAACTCCAAGGGAACAGGG + Intronic
957970638 3:87377342-87377364 CTGTGAACTCAATGTGAACGAGG + Intergenic
960140661 3:114149114-114149136 CTCTAAGCTCAAAGAGAACAGGG - Intronic
962880602 3:139573036-139573058 CTGTGAAATCACAGCCAACAAGG + Intronic
964447401 3:156774460-156774482 CTGTGTACTCAAAGAGAAGCTGG + Intergenic
964527069 3:157626325-157626347 CTGTGAACTCCAAGACAACCAGG + Intronic
967838521 3:193984719-193984741 CTGTGCACACAAAGAGAACCAGG - Intergenic
968661631 4:1801111-1801133 CTGTGAAGTCACAGGGCACAGGG - Intronic
970512081 4:16791197-16791219 TTGTGAACTCAAACCTAAAAGGG + Intronic
973642884 4:52920583-52920605 CTCTGAACTAAAAGAGAACTTGG + Intronic
974857738 4:67480871-67480893 CTGAGAACTGAAAGAGGACAAGG + Intronic
976548609 4:86367299-86367321 CTGTGAAATCATAGTGAACATGG - Intronic
976998483 4:91465295-91465317 CTTTGAAATCAATGGGAACAAGG + Intronic
989490998 5:42053384-42053406 AGGTGAACACAATGCGAACAAGG + Intergenic
991584679 5:68189874-68189896 CTGTGAACTCCAAGGGACCAAGG - Exonic
999015539 5:148100137-148100159 CTGAGAACTCAAAGGAAACCAGG - Intronic
999308900 5:150538785-150538807 CTGTGAGCTCCAAGGGAGCAGGG - Intronic
1001891124 5:175339674-175339696 CTGTGACCTCAAAGCCAAGATGG + Intergenic
1004557826 6:16716859-16716881 CTGTGAACTGAATGGCAACAAGG - Intronic
1004572619 6:16862582-16862604 CTGTGCATTCCAAGAGAACAAGG - Intergenic
1009942264 6:70303171-70303193 GTGTGTCCTCAAAGCTAACAAGG + Intergenic
1010092335 6:71998488-71998510 ATGTAAACTCCAAGAGAACAGGG + Intronic
1010976976 6:82326145-82326167 CTGTGAGAACAAAGAGAACAGGG - Intergenic
1011635849 6:89372289-89372311 CTCTGAACTCCAAGCCAAGAGGG + Intronic
1011785834 6:90843957-90843979 CTTTGAAGACAAAGCGAACTTGG + Intergenic
1019497761 7:1348320-1348342 CTGTGAGCTCCATGGGAACAGGG + Intergenic
1020589085 7:10111659-10111681 CTGTGAACAGCAAGCAAACAAGG + Intergenic
1030632801 7:111913935-111913957 CTGTGTAGTCATAGCCAACATGG - Intronic
1036199683 8:6758327-6758349 CTGTGAAATCAAAGAGAAGCAGG - Exonic
1037602741 8:20411768-20411790 CTGTAAACTCATAATGAACACGG - Intergenic
1038079141 8:24112908-24112930 CAGTGAAATCAAAGACAACATGG - Intergenic
1038084297 8:24176144-24176166 CTATGAAGACAAAGCAAACAGGG - Intergenic
1040700472 8:50057484-50057506 CTGTAAAATGAAAGAGAACAAGG + Intronic
1042433491 8:68736507-68736529 CTCTGAACTCATATCAAACAAGG - Intronic
1049224093 8:141441449-141441471 CTGTGACCTCCTAGGGAACAAGG - Intergenic
1051078121 9:13264800-13264822 CTGTTAACTCACACCAAACATGG + Intronic
1052407760 9:28083848-28083870 GTGTGAAGTCAAAGTGAAAAAGG + Intronic
1057552562 9:96062861-96062883 CTGTGAACTGAAAGGTCACAGGG - Intergenic
1058319732 9:103614390-103614412 CAGTGAACTTCAAGCAAACATGG - Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1186813868 X:13216579-13216601 CTGTGAAATCAAATCAAACATGG - Intergenic
1187768602 X:22670455-22670477 CTGTGTCCTCAAAGGTAACATGG - Intergenic
1187836443 X:23436607-23436629 CTGTGAAATCCAGGCAAACAAGG + Intergenic
1189290749 X:39884055-39884077 CTCTAAACTCAAAGTGGACAAGG + Intergenic
1191901619 X:66046582-66046604 CTGTGAAGTCAAGGCGAAGGAGG - Intergenic
1193946841 X:87747862-87747884 CTGTGAACTCAAAGCGAATGCGG - Intergenic
1201289656 Y:12410668-12410690 GTGTGAACCCCAAGCCAACAAGG + Intergenic